Difference between revisions of "Chromosome IX History"
(Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31. <br> *The se...") |
(→Annotation Changes without sequence changes) |
||
Line 151: | Line 151: | ||
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6" | ||
! Date !! Affected Features | ! Date !! Affected Features | ||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS911 ARS911], [https://www.yeastgenome.org/locus/ARS912 ARS912], [https://www.yeastgenome.org/locus/ARS913 ARS913], [https://www.yeastgenome.org/locus/ARS914 ARS914], [https://www.yeastgenome.org/locus/ARS920 ARS920], [https://www.yeastgenome.org/locus/ARS922 ARS922], [https://www.yeastgenome.org/locus/ARS923 ARS923]<br> | ||
+ | As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922.<br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS909 ARS909], [https://www.yeastgenome.org/locus/ARS913 ARS913], [https://www.yeastgenome.org/locus/ARS914 ARS914], [https://www.yeastgenome.org/locus/ARS919 ARS919], [https://www.yeastgenome.org/locus/ARS922 ARS922], [https://www.yeastgenome.org/locus/ARS923 ARS923]<br> | ||
+ | The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922.<br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] | ||
+ | |||
+ | |- | ||
+ | | 2014-11-19 | ||
+ | | [https://www.yeastgenome.org/locus/ARS909 ARS907] <br> | ||
+ | ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2.<br> <br> | ||
+ | '''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br> | ||
+ | [https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text] |
Revision as of 14:35, 30 September 2019
This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 9 times, affecting 12 features.
- The annotation of Chromosome VII has been updated 232 times, affecting 63 features.
- Current and past versions can be obtained from SGD's Download site.
Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | tK(CUU)I | 300235 | 300235 | Insertion | G | |
A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer.
New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL012W | 333321 | 333321 | Insertion | C | |
A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL123W | 128409 | 128409 | Insertion | CT | |
128403 | 128403 | Insertion | C | |||
Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460 ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL083C | 203638 | 203638 | Substitution | A | C |
A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR039C, YIRCdelta6 | 427189 | 427189 | Insertion | A | |
A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL051C, YIL052C | 257479 | 257479 | Deletion | A | |
A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C.
New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIR041W, YIR042C | 435029 | 435029 | Deletion | G | |
A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C.
New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YIL056W, tS(UGA)I | 249623 | 249623 | Deletion | T | |
A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W.
New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |
Annotation Changes without sequence changes
Date | Affected Features |
---|---|
2014-11-19 | ARS911, ARS912, ARS913, ARS914, ARS920, ARS922, ARS923 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922. |
2014-11-19 | ARS909, ARS913, ARS914, ARS919, ARS922, ARS923 The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922. |
2014-11-19 | ARS907 ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. |