Chromosome IX History

This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.

• The sequence of Chromosome VII has been updated 9 times, affecting 12 features.
  
• The annotation of Chromosome VII has been updated 232 times, affecting 63 features.
  
• Current and past versions can be obtained from SGD's Download site.

Sequence Changes

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2011-02-03	tK(CUU)I	300235	300235	Insertion		G
	A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer. New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIL012W	333321	333321	Insertion		C
	A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter. New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIL123W	128409	128409	Insertion		CT
		128403	128403	Insertion		C
	Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed. New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460 ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIL083C	203638	203638	Substitution	A	C
	A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine. New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIR039C, YIRCdelta6	427189	427189	Insertion		A
	A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C. New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIL051C, YIL052C	257479	257479	Deletion	A
	A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C. New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIR041W, YIR042C	435029	435029	Deletion	G
	A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C. New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text
2011-02-03	YIL056W, tS(UGA)I	249623	249623	Deletion	T
	A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W. New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. SGD paper | PubMed | Full-Text

Annotation Changes without sequence changes

Date	Affected Features
2014-11-19	ARS911, ARS912, ARS913, ARS914, ARS920, ARS922, ARS923 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ARS909, ARS913, ARS914, ARS919, ARS922, ARS923 The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text
2014-11-19	ARS907 ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. SGD paper | PubMed | Full-Text