Difference between revisions of "Chromosome VIII History"
(Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31. <br> *The...") |
|||
Line 88: | Line 88: | ||
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||
Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887</pre> | Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YHL037C YHL037C] | ||
+ | | 441869 | ||
+ | | 441869 | ||
+ | | Deletion | ||
+ | | G | ||
+ | | | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter. | ||
+ | <pre>New 25801 ATGCAAGGGTTATGG-CATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25859 | ||
+ | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 25798 ATGCAAGGGTTATGGGCATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25857</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YHL047C YHL047C] | ||
+ | | 8358 | ||
+ | | 8358 | ||
+ | | Insertion | ||
+ | | | ||
+ | | G | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter. | ||
+ | <pre>New 8341 TAAATCTTTCTTATGACCTGCCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8400 | ||
+ | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 8340 TAAATCTTTCTTATGACCT-CCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8398</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YHR056C YHR056C], [https://www.yeastgenome.org/locus/YHR056W-A YHR056W-A] | ||
+ | | 217753 | ||
+ | | 217753 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | T | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C. | ||
+ | <pre>New 217731 CAATTCCCACATATCGGTTTTGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217790 | ||
+ | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||
+ | Old 217733 CAATTCCCACATATCGGTTTGGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217792</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YHR072W YHR072W] | ||
+ | | 240687 | ||
+ | | 240687 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution within the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid. | ||
+ | <pre>New 240651 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGT 240710 | ||
+ | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||
+ | Old 240653 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGT 240712</pre> | ||
+ | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
+ | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | ||
+ | |||
+ | |- style="height:30px; width:30px; text-align:center;" | ||
+ | | 2011-02-03 | ||
+ | | [https://www.yeastgenome.org/locus/YHR197W YHR197W] | ||
+ | | 496180 | ||
+ | | 496180 | ||
+ | | Substitution | ||
+ | | G | ||
+ | | A | ||
+ | |- | ||
+ | | || colspan="6" | A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine. | ||
+ | <pre>New 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA 496186 | ||
+ | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||
+ | Old 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA 496186</pre> | ||
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br> | ||
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] | [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text] |
Revision as of 10:09, 30 September 2019
This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.
- The sequence of Chromosome VII has been updated 33 times, affecting 40 features.
- The annotation of Chromosome VII has been updated 24 times, affecting 69 features.
- Current and past versions can be obtained from SGD's Downloads.
Contents
[hide]Sequence Changes
Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
---|---|---|---|---|---|---|
2011-02-03 | ARS814, YHR092C | 287178 | 287178 | Insertion | C | |
287123 | 287123 | Deletion | C | |||
287116 | 287116 | Deletion | G | |||
One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
New 287091 CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT 287148 ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| Old 287093 CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT 287152 New 287149 CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287208 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Old 287153 CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT 287211 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR049C-A | 207353 | 207353 | Deletion | A | |
A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New 207360 GTGCTGCTAA-CCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207418 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old 207353 GTGCTGCTAAACCCCGCCCGGCGCGAAAAATCCACCCGGGGTGCTTTAGCGTGGCTTACGAAGACCTTTT 207412 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR095W | 293374 | 293374 | Insertion | C | |
A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
New 293329 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCGCAAGTAGTCCCTGCCAT 293388 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old 293332 TACGTTTTTGCAAGCAAAAATGAAGATAATCCGAGCGCATGCG-AAGTAGTCCCTGCCAT 293390 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR168W | 441869 | 441869 | Insertion | G | |
A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New 441827 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATAGATGTGTTAA 441886 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Old 441829 GTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATAGATGTGTTAA 441887 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL037C | 441869 | 441869 | Deletion | G | |
A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
New 25801 ATGCAAGGGTTATGG-CATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25859 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old 25798 ATGCAAGGGTTATGGGCATGCGCATCCATGTGGCGTTTCCTACTTTTATTTTTACATAAT 25857 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHL047C | 8358 | 8358 | Insertion | G | |
A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 8341 TAAATCTTTCTTATGACCTGCCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8400 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old 8340 TAAATCTTTCTTATGACCT-CCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGTCATTGA 8398 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR056C, YHR056W-A | 217753 | 217753 | Substitution | G | T |
A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C.
New 217731 CAATTCCCACATATCGGTTTTGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217790 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Old 217733 CAATTCCCACATATCGGTTTGGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217792 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR072W | 240687 | 240687 | Substitution | G | A |
A single nucleotide substitution within the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.
New 240651 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGT 240710 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Old 240653 AATGGAAACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGT 240712 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. | ||||||
2011-02-03 | YHR197W | 496180 | 496180 | Substitution | G | A |
A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGAAGAATA 496186 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old 496127 GTTTGAAATTCCCGCTATCGAATTAAGTGATGACGAAGAGGAGGAGGAAGAAGGAGAATA 496186 Engel SR, et al. (2014) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. |