Chromosome XV History - Revision history

Sage: /* Sequence Changes */

2019-10-03T00:14:19Z

‎Sequence Changes

Sage: /* Annotation Changes without sequence changes */

2019-10-03T00:09:20Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-03T00:03:29Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:48:26Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:45:02Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:43:22Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:39:56Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:37:05Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:32:51Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T23:24:57Z

‎Annotation Changes without sequence changes

@@ Line 59: / Line 59: @@
                  |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 Old    55990    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC  56049</pre>
 '''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
 [http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

← Older revision		Revision as of 00:09, 3 October 2019
Line 1,132:		Line 1,132:
	'''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. <br>		'''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. <br>
	[https://www.yeastgenome.org/reference/S000049529 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] \| [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br>		[https://www.yeastgenome.org/reference/S000049529 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] \| [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br>
		+	\|-
		+	\| 2000-08-14
		+	\| [https://www.yeastgenome.org/locus/YOR239W YOR239W], [https://www.yeastgenome.org/locus/YOR240W YOR240W] <br>
		+	Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs.<br><br>
		+	'''Asakura T, et al.''' (1998) Isolation and characterization of a novel actin filament-binding protein from Saccharomyces cerevisiae. Oncogene 16(1):121-30. <br>
		+	[https://www.yeastgenome.org/reference/S000041861 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9467951 PubMed] \| [https://www.nature.com/articles/1201487 Full-Text] <br>
		+	\|-
		+	\| 2000-08-11
		+	\| [https://www.yeastgenome.org/locus/YOL052C-A YOL052C-A] <br>
		+	Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature <br><br>
		+	\|-
		+	\| 2000-07-14
		+	\| [https://www.yeastgenome.org/locus/YOL047C YOL047C] <br>
		+	The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. ''Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612.'' <br><br>
		+	\|-
		+	\| 1999-07-17
		+	\| [https://www.yeastgenome.org/locus/YOL075C YOL075C] <br>
		+	The start site of YOL075C was moved 597 bases upstream. ''Chromosomal coordinates change from 194944-189657 to 193541-189657.'' <br><br>
		+	\|-
		+	\| 1998-05-21
		+	\| [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOR298C-A YOR298C-A] <br>
		+	The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
		+	The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+	\|-
		+	\| 1997-07-01
		+	\| [https://www.yeastgenome.org/locus/YOR304C-A YOR304C-A] <br>
		+	The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included. <br><br>
		+
		+	\|}

← Older revision		Revision as of 00:03, 3 October 2019
Line 1,084:		Line 1,084:
	'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>		'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
	[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>		[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YOL013W-A YOL013W-A], [https://www.yeastgenome.org/locus/YOL038C-A YOL038C-A]
		+	Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A.<br><br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YOL019W-A YOL019W-A], [https://www.yeastgenome.org/locus/YOL085W-A YOL085W-A], [https://www.yeastgenome.org/locus/YOL166W-A YOL166W-A], [https://www.yeastgenome.org/locus/YOR032W-A YOR032W-A], [https://www.yeastgenome.org/locus/YOR108C-A YOR108C-A], [https://www.yeastgenome.org/locus/YOR161C-C YOR161C-C], [https://www.yeastgenome.org/locus/YOR161W-A YOR161W-A], [https://www.yeastgenome.org/locus/YOR161W-B YOR161W-B], [https://www.yeastgenome.org/locus/YOR186C-A YOR186C-A], [https://www.yeastgenome.org/locus/YOR231C-A YOR231C-A], [https://www.yeastgenome.org/locus/YOR335W-A YOR335W-A], [https://www.yeastgenome.org/locus/YOR394C-A YOR394C-A], [https://www.yeastgenome.org/locus/YOR396C-A YOR396C-A] <br>
		+	Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A.<br><br>
		+	'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
		+	[https://www.yeastgenome.org/reference/S000073673 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] \| [https://www.nature.com/articles/nbt0102-58 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] \| [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YOR020W-A YOR020W-A] <br>
		+	Thanks to Brachat et al. for providing the coordinates of YOR020W-A.<br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YOL164W-A YOL164W-A], [https://www.yeastgenome.org/locus/YOR011W-A YOR011W-A], [https://www.yeastgenome.org/locus/YOR072W-A YOR072W-A], [https://www.yeastgenome.org/locus/YOR073W-A YOR073W-A], [https://www.yeastgenome.org/locus/YOR316C-A YOR316C-A], [https://www.yeastgenome.org/locus/YOR329W-A YOR329W-A], [https://www.yeastgenome.org/locus/YOR376W-A YOR376W-A], [https://www.yeastgenome.org/locus/YOR381W-A YOR381W-A] <br>
		+	Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A.<br><br>
		+	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
		+	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
		+	\|-
		+	\| 2003-01-09
		+	\| [https://www.yeastgenome.org/locus/YOL002C YOL002C] <br>
		+	The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD.<br><br>
		+	'''Karpichev IV, et al.''' (2002) Multiple regulatory roles of a novel Saccharomyces cerevisiae protein, encoded by YOL002c, in lipid and phosphate metabolism. J Biol Chem 277(22):19609-17. <br>
		+	[https://www.yeastgenome.org/reference/S000069897 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11916977 PubMed] \| [http://www.jbc.org/content/277/22/19609.long Full-Text] <br>
		+	\|-
		+	\| 2001-03-08
		+	\| [https://www.yeastgenome.org/locus/snR31 snR31] <br>
		+	Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953).<br><br>
		+	'''Dandekar T and Tollervey D''' (1993) Identification and functional analysis of a novel yeast small nucleolar RNA. Nucleic Acids Res 21(23):5386-90. <br>
		+	[https://www.yeastgenome.org/reference/S000050561 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/8265353 PubMed] \| [https://academic.oup.com/nar/article/21/23/5386/1050939 Full-Text] <br>
		+	'''Balakin AG, et al.''' (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7. <br>
		+	[https://www.yeastgenome.org/reference/S000050562 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/8265354 PubMed] \| [https://academic.oup.com/nar/article/21/23/5391/1050948 Full-Text] <br>
		+	\|-
		+	\| 2001-03-06
		+	\| [https://www.yeastgenome.org/locus/ARS1502 ARS1502] <br>
		+	Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan <br><br>
		+	\|-
		+	\| 2000-10-17
		+	\| [https://www.yeastgenome.org/locus/ARS1501 ARS1501] <br>
		+	ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501. <br><br>
		+	'''Raychaudhuri S, et al.''' (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64. <br>
		+	[https://www.yeastgenome.org/reference/S000044083 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9396816 Full-Text] \| [https://academic.oup.com/nar/article/25/24/5057/1749133 Full-Text] <br>
		+	'''Walker SS, et al.''' (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62. <br>
		+	[https://www.yeastgenome.org/reference/S000049529 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/1956786 PubMed] \| [https://academic.oup.com/nar/article/19/22/6255/1015625 Full-Text] <br>

← Older revision		Revision as of 23:48, 2 October 2019
Line 1,070:		Line 1,070:
	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>		'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>		[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
		+	\|-
		+	\| 2003-09-09
		+	\| [https://www.yeastgenome.org/locus/TEL15L TEL15L], [https://www.yeastgenome.org/locus/TEL15R TEL15R] <br>
		+	The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YOL083C-A YOL083C-A], [https://www.yeastgenome.org/locus/YOL097W-A YOL097W-A], [https://www.yeastgenome.org/locus/YOL155W-A YOL155W-A], [https://www.yeastgenome.org/locus/YOR034C-A YOR034C-A], [https://www.yeastgenome.org/locus/YOR072W-B YOR072W-B], [https://www.yeastgenome.org/locus/YOR192C-C YOR192C-C], [https://www.yeastgenome.org/locus/YOR293C-A YOR293C-A] <br>
		+	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A.<br><br>
		+	'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
		+	[https://www.yeastgenome.org/reference/S000042214 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] \| [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+	'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
		+	[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>

@@ Line 1,050: / Line 1,050: @@
 '''Takayama Y, et al.''' (2003) GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 17(9):1153-65. <br>
 [https://www.yeastgenome.org/reference/S000073092 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12730134 PubMed] | [http://genesdev.cshlp.org/content/17/9/1153.long Full-Text] <br>
 '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
 '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>

← Older revision		Revision as of 23:37, 2 October 2019
Line 984:		Line 984:
	'''Foury F''' (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60. <br>		'''Foury F''' (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60. <br>
	[https://www.yeastgenome.org/reference/S000048961 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/2684980 PubMed] \| [http://www.jbc.org/content/264/34/20552.long Full-Text] <br>		[https://www.yeastgenome.org/reference/S000048961 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/2684980 PubMed] \| [http://www.jbc.org/content/264/34/20552.long Full-Text] <br>
		+	\|-
		+	\| 2004-10-12
		+	\| [https://www.yeastgenome.org/locus/CEN12 CEN12] <br>
		+	The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.<br><br>
		+	'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
		+	[https://www.yeastgenome.org/reference/S000059647 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] \| [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
		+	'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
		+	[https://www.yeastgenome.org/reference/S000074756 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] \| [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
		+	\|-
		+	\| 2004-04-21
		+	\| [https://www.yeastgenome.org/locus/YOR069W YOR069W] <br>
		+	Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).<br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
		+	\|-
		+	\| 2003-09-27
		+	\| [https://www.yeastgenome.org/locus/YOL048C YOL048C] <br>
		+	Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.<br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YOR125C YOR125C] <br>
		+	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs.<br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YOL096C YOL096C] <br>
		+	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA).<br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>

← Older revision		Revision as of 23:32, 2 October 2019
Line 954:		Line 954:
	'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>		'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
	[https://www.yeastgenome.org/reference/S000082006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] \| [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>		[https://www.yeastgenome.org/reference/S000082006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] \| [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
		+	\|-
		+	\| 2005-12-01
		+	\| [https://www.yeastgenome.org/locus/YOR221C YOR221C] <br>
		+	Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus.<br><br>
		+	'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
		+	[https://www.yeastgenome.org/reference/S000042737 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] \| [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	\|-
		+	\| 2005-12-01
		+	\| [https://www.yeastgenome.org/locus/YOR074C YOR074C] <br>
		+	Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation.<br><br>
		+	'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
		+	[https://www.yeastgenome.org/reference/S000042737 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] \| [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
		+	'''Taylor GR, et al.''' (1987) Molecular characterization of the cell cycle-regulated thymidylate synthase gene of Saccharomyces cerevisiae. J Biol Chem 262(11):5298-307. <br>
		+	[https://www.yeastgenome.org/reference/S000049320 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/3031048 PubMed] \| [http://www.jbc.org/content/262/11/5298.long Full-Text] <br>
		+	'''Poon PP and Storms RK''' (1994) Thymidylate synthase is localized to the nuclear periphery in the yeast Saccharomyces cerevisiae. J Biol Chem 269(11):8341-7. <br>
		+	[https://www.yeastgenome.org/reference/S000058478 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/8132557 PubMed] \| [http://www.jbc.org/content/269/11/8341.long Full-Text] <br>
		+	\|-
		+	\| 2005-11-30
		+	\| [https://www.yeastgenome.org/locus/YOR147W YOR147W] <br>
		+	Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream.<br><br>
		+	'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
		+	[https://www.yeastgenome.org/reference/S000082006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] \| [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
		+	\|-
		+	\| 2005-11-30
		+	\| [https://www.yeastgenome.org/locus/YOR330C YOR330C] <br>
		+	Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream.<br><br>
		+	'''Foury F''' (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60. <br>
		+	[https://www.yeastgenome.org/reference/S000048961 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/2684980 PubMed] \| [http://www.jbc.org/content/264/34/20552.long Full-Text] <br>

← Older revision		Revision as of 23:24, 2 October 2019
Line 902:		Line 902:
	'''Malys N, et al.''' (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600. <br>		'''Malys N, et al.''' (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600. <br>
	[https://www.yeastgenome.org/reference/S000076812 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15240832 PubMed] \| [https://academic.oup.com/nar/article/32/12/3590/2375813 Full-Text] <br>		[https://www.yeastgenome.org/reference/S000076812 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15240832 PubMed] \| [https://academic.oup.com/nar/article/32/12/3590/2375813 Full-Text] <br>
		+	\|-
		+	\| 2006-10-03
		+	\| [https://www.yeastgenome.org/locus/YOR211C YOR211C] <br>
		+	Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.<br><br>
		+	'''Shepard KA and Yaffe MP''' (1999) The yeast dynamin-like protein, Mgm1p, functions on the mitochondrial outer membrane to mediate mitochondrial inheritance. J Cell Biol 144(4):711-20. <br>
		+	[https://www.yeastgenome.org/reference/S000047437 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10037792 PubMed] \| [http://jcb.rupress.org/content/144/4/711.long Full-Text] <br>
		+	\|-
		+	\| 2006-10-02
		+	\| [https://www.yeastgenome.org/locus/ARS1531 ARS1531] <br>
		+	ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.<br><br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-09-08
		+	\| [https://www.yeastgenome.org/locus/ARS1507 ARS1507], [https://www.yeastgenome.org/locus/ARS1508 ARS1508], [https://www.yeastgenome.org/locus/ARS1509 ARS1509], [https://www.yeastgenome.org/locus/ARS1510 ARS1510], [https://www.yeastgenome.org/locus/ARS1511 ARS1511], [https://www.yeastgenome.org/locus/ARS1513 ARS1513], [https://www.yeastgenome.org/locus/ARS1519 ARS1519], [https://www.yeastgenome.org/locus/ARS1521 ARS1521], [https://www.yeastgenome.org/locus/ARS1523 ARS1523], [https://www.yeastgenome.org/locus/ARS1524 ARS1524], [https://www.yeastgenome.org/locus/ARS1526 ARS1526], [https://www.yeastgenome.org/locus/ARS1528 ARS1528], [https://www.yeastgenome.org/locus/ARS1529 ARS1529] <br>
		+	The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529. <br> <br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-09-08
		+	\| [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br>
		+	The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006.<br><br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-05-11
		+	\| [https://www.yeastgenome.org/locus/YOR197W YOR197W] <br>
		+	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream.<br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2006-04-12
		+	\| [https://www.yeastgenome.org/locus/ARS1516 ARS1516] <br>
		+	ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987.<br><br>
		+	'''Sasnauskas KV, et al.''' (1987) [Cloning of the ADE2 gene of Saccharomyces cerevisiae and localization of the ARS-sequence] Genetika 23(7):1141-8. <br>
		+	[https://www.yeastgenome.org/reference/S000048074 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/2888707 PubMed] <br>
		+	'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60. <br>
		+	[https://www.yeastgenome.org/reference/S000069019 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] \| [https://science.sciencemag.org/content/294/5550/2357.long Full-Text] \| [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]<br>
		+	\|-
		+	\| 2006-01-24
		+	\| [https://www.yeastgenome.org/locus/snR81 snR81] <br>
		+	New snoRNA added to genome annotation (GenBank accession # AY679769).<br><br>
		+	'''Schattner P, et al.''' (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96. <br>
		+	[https://www.yeastgenome.org/reference/S000081218 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15306656 PubMed] \| [https://academic.oup.com/nar/article/32/14/4281/1279684 Full-Text] <br>
		+	\|-
		+	\| 2005-12-01
		+	\| [https://www.yeastgenome.org/locus/YOR091W YOR091W] <br>
		+	Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream.<br><br>
		+	'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
		+	[https://www.yeastgenome.org/reference/S000082006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] \| [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>