Chromosome XVI History - Revision history

Stacia at 22:10, 21 April 2022

2022-04-21T22:10:29Z

Stacia: /* Annotation Changes without sequence changes */

2022-04-21T22:05:36Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-03T23:48:09Z

‎Annotation Changes without sequence changes

Show changes

Sage at 23:04, 3 October 2019

2019-10-03T23:04:21Z

Sage at 22:58, 3 October 2019

2019-10-03T22:58:04Z

Sage at 22:53, 3 October 2019

2019-10-03T22:53:04Z

Show changes

Sage: Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31.
*The s..."

2019-10-03T22:42:35Z

Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br> *The s..."

New page

This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br>
*The sequence of Chromosome XVI has been updated '''23''' times, affecting '''16''' features. <br>
*The annotation of Chromosome XVI has been updated '''39''' times, affecting '''72''' features. <br>
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

__FORCETOC__

=Sequence Changes=

{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
! Date !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence

← Older revision		Revision as of 23:04, 3 October 2019
Line 294:		Line 294:
	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>		'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>		[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+
		+	\|}
		+
		+	<br><br>
		+
		+	=Annotation Changes ''without sequence changes''=
		+	{\| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
		+	! Date !! Affected Features
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1605 ARS1605], [https://www.yeastgenome.org/locus/ARS1607 ARS1607], [https://www.yeastgenome.org/locus/ARS1621 ARS1621], [https://www.yeastgenome.org/locus/ARS1622 ARS1622], [https://www.yeastgenome.org/locus/ARS1625 ARS1625] <br>
		+	The chromosomal coordinates of the following ARS elements on Chromosome XVI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1605, ARS1607, ARS1621, ARS1622, ARS1625. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1604 ARS1604], [https://www.yeastgenome.org/locus/ARS1607 ARS1607], [https://www.yeastgenome.org/locus/ARS1614 ARS1614], [https://www.yeastgenome.org/locus/ARS1618 ARS1618], [https://www.yeastgenome.org/locus/ARS1619 ARS1619], [https://www.yeastgenome.org/locus/ARS1621 ARS1621], [https://www.yeastgenome.org/locus/ARS1622 ARS1622], [https://www.yeastgenome.org/locus/ARS1623 ARS1623], [https://www.yeastgenome.org/locus/ARS1624 ARS1624], [https://www.yeastgenome.org/locus/ARS1625 ARS1625], [https://www.yeastgenome.org/locus/ARS1626 ARS1626], [https://www.yeastgenome.org/locus/ARS1627 ARS1627], [https://www.yeastgenome.org/locus/ARS1628 ARS1628], [https://www.yeastgenome.org/locus/ARS1630 ARS1630], [https://www.yeastgenome.org/locus/ARS1631 ARS1631] <br>
		+	As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XVI based on Liachko et al. 2013: ARS1604, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]

← Older revision		Revision as of 22:58, 3 October 2019
Line 211:		Line 211:
	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>		'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]		[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YPL036W YPL036W], [https://www.yeastgenome.org/locus/YPL037C YPL037C]
		+	\| 482773
		+	\| 482773
		+	\| Deletion
		+	\| T
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide was deleted from the intergenic region between ORFs YPL037C/EGD1 and YPL036W/PMA2.
		+	<pre>New 482761 AAACATACCCATAAC-TTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482819
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 482758 AAACATACCCATAACTTTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482817</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YPR078C YPR078C], [https://www.yeastgenome.org/locus/YPR079W YPR079W]
		+	\| 698524
		+	\| 698524
		+	\| Deletion
		+	\| A
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide deletion was made in the intergenic region between ORFs YPR078C and YPR079W/MRL1.
		+	<pre>New 698519 TTCTTCTG-AAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698577
		+	\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 698516 TTCTTCTGAAAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698575</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| rowspan="4"\| 2004-07-21
		+	\| rowspan="4"\| [https://www.yeastgenome.org/locus/YPL109C YPL109C]
		+	\| 347273
		+	\| 347273
		+	\| Insertion
		+	\|
		+	\| T
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 347265
		+	\| 347265
		+	\| Deletion
		+	\| T
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 347285
		+	\| 347285
		+	\| Insertion
		+	\|
		+	\| A
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 347375
		+	\| 347375
		+	\| Insertion
		+	\|
		+	\| T
		+	\|-
		+	\| \|\| colspan="6" \| The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids.
		+	<pre>New: TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303</pre>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2003-09-29
		+	\| [https://www.yeastgenome.org/locus/YPR089W YPR089W], [https://www.yeastgenome.org/locus/YPR090W YPR090W]
		+	\| 713683
		+	\| 713683
		+	\| Deletion
		+	\| T
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W.<br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

@@ Line 1: / Line 1: @@
 This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31. <br>
 *The sequence of Chromosome XVI has been updated '''23''' times, affecting '''16''' features. <br>
-*The annotation of Chromosome XVI has been updated '''39''' times, affecting '''72''' features. <br>
+*The annotation of Chromosome XVI has been updated '''40''' times, affecting '''73''' features. <br>
 *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

@@ Line 302: / Line 302: @@
 {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 ! Date  !! Affected Features
 |-
 | 2014-11-19