Chromosome XI History - Revision history

Stacia at 22:08, 21 April 2022

2022-04-21T22:08:56Z

Stacia: /* Annotation Changes without sequence changes */

2022-04-21T21:58:10Z

‎Annotation Changes without sequence changes

Sage at 19:52, 4 October 2019

2019-10-04T19:52:02Z

Sage: /* Annotation Changes without sequence changes */

2019-10-01T23:30:56Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-01T23:11:57Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-01T22:48:33Z

‎Annotation Changes without sequence changes

Sage at 22:35, 1 October 2019

2019-10-01T22:35:07Z

Sage: /* Sequence Changes */

2019-10-01T22:07:31Z

‎Sequence Changes

Sage: /* Sequence Changes */

2019-10-01T20:57:25Z

‎Sequence Changes

Sage: /* Sequence Changes */

2019-10-01T20:51:18Z

‎Sequence Changes

@@ Line 1: / Line 1: @@
 This page lists all sequence and annotation changes that have been made to the Chromosome XI systematic reference sequence since its intial release on 1996-07-31. <br>
 *The sequence of Chromosome XI has been updated '''79''' times, affecting '''53''' features. <br>
-*The annotation of Chromosome XI has been updated '''39''' times, affecting '''55''' features. <br>
+*The annotation of Chromosome XI has been updated '''40''' times, affecting '''56''' features. <br>
 *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

@@ Line 1,053: / Line 1,053: @@
 {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 ! Date  !! Affected Features
 |-
 | 2014-11-19

@@ Line 1,300: / Line 1,300: @@
 |-
 | 1998-05-21
-| [https://www.yeastgenome.org/locus/YKL033W-A YKL033W-A], [https://www.yeastgenome.org/locus/YKL053C-A YKL053C-A], https://www.yeastgenome.org/locus/YKL162C-A YKL162C-A] <br>
+| [https://www.yeastgenome.org/locus/YKL033W-A YKL033W-A], [https://www.yeastgenome.org/locus/YKL053C-A YKL053C-A], [https://www.yeastgenome.org/locus/YKL162C-A YKL162C-A] <br>
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
 The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br>

← Older revision		Revision as of 23:30, 1 October 2019
Line 1,204:		Line 1,204:
	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>		'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>		[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YKR038C YKR038C]<br>
		+	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR038C be moved 105 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although there is an upstream ATG in S. paradoxus, an insertion causes a frame shift between this ATG and the predicted start site; 4) Sequence comparison to the nr dataset shows there is no sequence similarity between S. cerevisiae and other species between the first and second ATG; the sequence similarities begin after the 2nd ATG. <br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YKR045C YKR045C]<br>
		+	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR045C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2003-09-09
		+	\| [https://www.yeastgenome.org/locus/TEL11L TEL11L], [https://www.yeastgenome.org/locus/TEL11R TEL11R] <br>
		+	The chromosomal locations for TEL11R-TR, TEL11R-XR, TEL11R-XC, TEL11R, TEL11L-TR, TEL11L-XR, TEL11L-XC, and TEL11L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).<br><br>
		+	\|-
		+	\| 2003-08-07
		+	\| [https://www.yeastgenome.org/locus/YKR099C-A YKR099C-A]<br>
		+	The chromosomal coordinates of ORF YKR099C-A were shifted 1 nucleotide downstream, from 638723-638532 to 638722-638531. Note that the sequence remains unchanged. <br><br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKR099C-A YKR099C-A]<br>
		+	Thanks to [https://bioinformatik.wzw.tum.de/index.php?id=63 MIPS] for providing the coordinates of YKL158W. <br><br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKR095W-A YKR095W-A]<br>
		+	Thanks to Brachat et al and Cliften et al. for providing the coordinates of YKR095W-A. <br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKL096C-B YKL096C-B], [https://www.yeastgenome.org/locus/YKL156C-A YKL156C-A], [https://www.yeastgenome.org/locus/YKR075W-A YKR075W-A] <br>
		+	Thanks to Kumar et al. for providing the coordinates of the following Chromosome XI ORFs: YKL096C-B, YKR075W-A, and YKL156C-A. <br><br>
		+	'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
		+	[https://www.yeastgenome.org/reference/S000073673 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] \| [https://www.nature.com/articles/nbt0102-58 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] \| [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKL183C-A YKL183C-A], [https://www.yeastgenome.org/locus/YKR004C-A YKR004C-A] <br>
		+	Thanks to Kessler et al. for providing the coordinates of the following Chromosome XI ORFs: YKL183C-A and YKR004C-A. <br><br>
		+	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
		+	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKL100W-A YKL100W-A], [https://www.yeastgenome.org/locus/YKL145W-A YKL145W-A], [https://www.yeastgenome.org/locus/YKR099C-A YKR099C-A] <br>
		+	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XI ORFs: YKL100W-A, YKL145W-A, and YKR099C-A. <br><br>
		+	'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
		+	[https://www.yeastgenome.org/reference/S000042214 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] \| [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+	'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
		+	[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YKL068W-A YKL068W-A] <br>
		+	Thanks to Brachat et al. for providing the coordinates of YKL068W-A. <br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
		+	\|-
		+	\| 2001-03-14
		+	\| [https://www.yeastgenome.org/locus/YKL003W-A YKL003W-A] <br>
		+	This ORF was initially added to SGD on 2001-02-26 based on homology (Blandin et al.), but was subsequently deleted because it is contained within DID4/YKL002W (Mark Hochstrasser, personal communication; Amerik et al.). <br><br>
		+	'''Amerik AY, et al.''' (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80. <br>
		+	[https://www.yeastgenome.org/reference/S000059113 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11029042 PubMed] \| [https://www.molbiolcell.org/doi/full/10.1091/mbc.11.10.3365?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text] <br>
		+	'''Blandin G, et al.''' (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6. <br>
		+	[https://www.yeastgenome.org/reference/S000065690 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11152879 PubMed] \| [https://febs.onlinelibrary.wiley.com/doi/full/10.1016/S0014-5793%2800%2902275-4 Full-Text] <br>
		+	\|-
		+	\| 2001-03-09
		+	\| [https://www.yeastgenome.org/locus/snR42 snR42] <br>
		+	Changed from W -> C: old start coord: 558652; old stop coord: 559002 new start coord: 559002; new stop coord: 558652 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA Database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataB ase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706 <br><br>
		+	\|-
		+	\| 2000-12-01
		+	\| [https://www.yeastgenome.org/locus/YKL199C YKL199C] <br>
		+	The start site of YKL199C was moved 276 nucleotides upstream, increasing the size of the ORF from 564 nt to 840 nt, and the size of the predicted protein from 187 amino acids to 279 aa. <br><br>
		+	\|-
		+	\| 2000-08-11
		+	\| [https://www.yeastgenome.org/locus/YKL096W-A YKL096W-A] <br>
		+	Old name: YKL097W-A; new name: YKL096W-A; date: 11/1998; old coord: ChrXI 258895 259173; SGDID: S0001956; Name changed due to nomenclature. <br><br>
		+	\|-
		+	\| 2000-07-22
		+	\| [https://www.yeastgenome.org/locus/YKL002W YKL002W] <br>
		+	The start site of YKL002W was moved 243 bp upstream, and a 68-bp intron was added at relative coordinates 61-128. <br><br>
		+	\|-
		+	\| 2000-07-14
		+	\| [https://www.yeastgenome.org/locus/YKL157W YKL157W], [https://www.yeastgenome.org/locus/YKL158W YKL158W] <br>
		+	YKL157W and YKL158W were merged into a single ORF, designated YKL157W, based on evidence published by Davis et al. 2000 demonstrating the presence of an intron between these two ORFs. <br><br>
		+	'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
		+	[https://www.yeastgenome.org/reference/S000042737 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] \| [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
		+	\|-
		+	\| 1998-05-21
		+	\| [https://www.yeastgenome.org/locus/YKL033W-A YKL033W-A], [https://www.yeastgenome.org/locus/YKL053C-A YKL053C-A], https://www.yeastgenome.org/locus/YKL162C-A YKL162C-A] <br>
		+	The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
		+	The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+
		+	\|}

← Older revision		Revision as of 23:11, 1 October 2019
Line 1,140:		Line 1,140:
	'''Davis CA and Ares M Jr''' (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7. <br>		'''Davis CA and Ares M Jr''' (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7. <br>
	[https://www.yeastgenome.org/reference/S000114459 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16484372 PubMed] \| [https://www.pnas.org/content/103/9/3262.long Full-Text] \| [https://www.pnas.org/content/suppl/2006/02/16/0507783103.DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=16484372&db=pmid YFGdb] <br>		[https://www.yeastgenome.org/reference/S000114459 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16484372 PubMed] \| [https://www.pnas.org/content/103/9/3262.long Full-Text] \| [https://www.pnas.org/content/suppl/2006/02/16/0507783103.DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=16484372&db=pmid YFGdb] <br>
		+	\|-
		+	\| 2005-11-17
		+	\| [https://www.yeastgenome.org/locus/YKL023C-A YKL023C-A] [https://www.yeastgenome.org/locus/YKL065W-A YKL065W-A] <br>
		+	Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following ORFs be added to the annotation of Chromosome XI: YKL065W-A and YKL023C-A.<br> <br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2005-11-03
		+	\| [https://www.yeastgenome.org/locus/YKR042W YKR042W] <br>
		+	The work of Zhang and Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of UTH1/YKR042W be moved 255 nt downstream from 518914 to 519169. This annotation change results in a predicted protein of 365 aa, as opposed to the previously annotated 450 aa. <br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
		+	[https://www.yeastgenome.org/reference/S000082006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] \| [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>
		+	\|-
		+	\| 2004-10-12
		+	\| [https://www.yeastgenome.org/locus/CEN11 CEN11] <br>
		+	The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003). <br><br>
		+	'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60. <br>
		+	[https://www.yeastgenome.org/reference/S000059647 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] \| [https://academic.oup.com/nar/article/29/5/1054/2381189 Full-Text]<br>
		+	'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68. <br>
		+	[https://www.yeastgenome.org/reference/S000074756 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] \| [https://www.molbiolcell.org/doi/full/10.1091/mbc.e02-08-0533?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed Full-Text]<br>
		+	\|-
		+	\| 2004-03-08
		+	\| [https://www.yeastgenome.org/locus/YKR004C YKR004C], [https://www.yeastgenome.org/locus/YKR004C-A YKR004C-A] <br>
		+	The small ORF YKR004C-A was added based on Kessler et al. 2003. However, Brachat et al. 2003 demonstrated that this ORF is actually an exon of YKR004C. Based on this information, YKR004C-A has been merged into YKR004C. <br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
		+	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
		+	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
		+	\|-
		+	\| 2004-02-09
		+	\| [https://www.yeastgenome.org/locus/YKL157W YKL157W], [https://www.yeastgenome.org/locus/YKL158W YKL158W] <br>
		+	In July 2003, YKL158W was mistakenly added back to SGD as an independent ORF. This annotation mistake has been corrected, and YKL158W has again been "merged" into YKL157W. <br><br>
		+	'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6. <br>
		+	[https://www.yeastgenome.org/reference/S000042737 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] \| [https://academic.oup.com/nar/article/28/8/1700/1009222 Full-Text] <br>
		+	\|-
		+	\| 2004-01-29
		+	\| [https://www.yeastgenome.org/locus/YKR095W-A YKR095W-A]<br>
		+	The coordinates for Exon1 and the intron have changed. The 5' end of Exon1 has been moved 210 bp downstream, and the size of the intron has been reduced from 300 bp to 75 bp. Note that there is no change to Exon2.<br><br>
		+	\|-
		+	\| 2003-09-27
		+	\| [https://www.yeastgenome.org/locus/YKR004C YKR004C]<br>
		+	Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for ECM9/YKR004C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has an 85-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators. <br><br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YKR006C YKR006C]<br>
		+	Based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003, the translation start site for MRPL13/YKR006C was moved 33 nt (11 codons) downstream. Evidence supporting this change includes: 1) The upstream ATG is not conserved in 3 related Saccharomyces species; 2) The reading frame is conserved only after the 2nd ATG; 3) Although the amino terminus contains a mitochondrial targeting sequence (Grohmann et al. 1994), this protein is still predicted to be targeted to the mitochondrion even if it uses the proposed start methionine (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter).<br><br>
		+	'''Grohmann L, et al.''' (1994) The yeast nuclear gene MRP-L13 codes for a protein of the large subunit of the mitochondrial ribosome. Curr Genet 26(1):8-14. <br>
		+	[https://www.yeastgenome.org/reference/S000044496 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/7954901 PubMed] \| [https://link.springer.com/article/10.1007%2FBF00326298 Full-Text] <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	\|-
		+	\| 2003-09-22
		+	\| [https://www.yeastgenome.org/locus/YKL195W YKL195W]<br>
		+	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKL195W be moved 72 nt (24 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

← Older revision		Revision as of 22:48, 1 October 2019
Line 1,098:		Line 1,098:
	<br>		<br>
	[https://www.yeastgenome.org/reference/S000120506 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] \| [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>		[https://www.yeastgenome.org/reference/S000120506 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] \| [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
		+	\|-
		+	\| 2006-10-03
		+	\| [https://www.yeastgenome.org/locus/ARS1125 ARS1125], [https://www.yeastgenome.org/locus/ARS1126 ARS1126], [https://www.yeastgenome.org/locus/ARS1127 ARS1127] <br>
		+	The following ARS elements on Chromosome XI were added to the genome annotation based on Nieduszynski et al. 2006: ARS1125/ARS1104.5, ARS1126/ARS1106.3, ARS1127/ARS1106.7. <br> <br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-09-08
		+	\| [https://www.yeastgenome.org/locus/ARS1103 ARS1103], [https://www.yeastgenome.org/locus/ARS1106 ARS1106], [https://www.yeastgenome.org/locus/ARS1109 ARS1109], [https://www.yeastgenome.org/locus/ARS1112 ARS1112], [https://www.yeastgenome.org/locus/ARS1113 ARS1113], [https://www.yeastgenome.org/locus/ARS1114 ARS1114], [https://www.yeastgenome.org/locus/ARS1116 ARS1116], [https://www.yeastgenome.org/locus/ARS1118 ARS1118], [https://www.yeastgenome.org/locus/ARS1120 ARS1120], [https://www.yeastgenome.org/locus/ARS1123 ARS1123] <br>
		+	The following new ARS elements on Chromosome XI were added to SGD based on Nieduszynski et al. 2006: ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123. <br> <br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-05-08
		+	\| [https://www.yeastgenome.org/locus/YKL168C YKL168C] <br>
		+	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for KKQ8/YKL168C was moved 30 nt (10 codons) downstream.<br> <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2006-05-08
		+	\| [https://www.yeastgenome.org/locus/YKR036C YKR036C] <br>
		+	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for CAF4/YKR036C was moved 48 nt (16 codons) downstream.<br> <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2006-05-08
		+	\| [https://www.yeastgenome.org/locus/YKL207W YKL207W] <br>
		+	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YKL207W was moved 87 nt (29 codons) downstream.<br> <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata]<br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
		+	\|-
		+	\| 2006-03-02
		+	\| [https://www.yeastgenome.org/locus/snR87 snR87] <br>
		+	New snoRNA published by Davis and Ares.<br> <br>
		+	'''Davis CA and Ares M Jr''' (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7. <br>
		+	[https://www.yeastgenome.org/reference/S000114459 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16484372 PubMed] \| [https://www.pnas.org/content/103/9/3262.long Full-Text] \| [https://www.pnas.org/content/suppl/2006/02/16/0507783103.DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=16484372&db=pmid YFGdb] <br>

← Older revision		Revision as of 22:35, 1 October 2019
Line 1,045:		Line 1,045:
	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
	New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113</pre>		New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113</pre>
		+
		+	\|}
		+
		+	<br><br>
		+
		+	=Annotation Changes ''without sequence changes''=
		+	{\| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
		+	! Date !! Affected Features
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1103 ARS1103], [https://www.yeastgenome.org/locus/ARS1106 ARS1106], [https://www.yeastgenome.org/locus/ARS1125 ARS1125] <br>
		+	As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XI based on Liachko et al. 2013: ARS1103, ARS1125, ARS1106.<br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1106 ARS1106], [https://www.yeastgenome.org/locus/ARS1120 ARS1120], [https://www.yeastgenome.org/locus/ARS1125 ARS1125] <br>
		+	The chromosomal coordinates of the following ARS elements on Chromosome XI were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1125, ARS1106, ARS1120. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2009-05-06
		+	\| [https://www.yeastgenome.org/locus/ARS1102 ARS1102], [https://www.yeastgenome.org/locus/ARS1104 ARS1104], [https://www.yeastgenome.org/locus/ARS1115 ARS1115] <br>
		+	The following ARS elements on Chromosome XI were added to the genome annotation based on Raveendranathan et al. 2006: ARS1102, ARS1104, and ARS1115. <br> <br>
		+	'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br>
		+	[https://www.yeastgenome.org/reference/S000117571 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] \| [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text]
		+	\|-
		+	\| 2009-02-20
		+	\| [https://www.yeastgenome.org/locus/YKR101W YKR101W] <br>
		+	The annotated translation start of SIR1/YKR101W was moved 24 aa (72 nt) downstream based on Gallagher et al. 2009. The old chromosomal coordinates were 640106-642142, and are now 640178-642142. <br> <br>
		+	'''Gallagher JE, et al.''' (2009) Elaboration, diversification and regulation of the sir1 family of silencing proteins in Saccharomyces. Genetics 181(4):1477-91. <br>
		+	[https://www.yeastgenome.org/reference/S000129097 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/19171939 PubMed] \| [https://www.genetics.org/content/181/4/1477.long Full-Text]
		+	\|-
		+	\| 2007-09-05
		+	\| [https://www.yeastgenome.org/locus/YKR005C YKR005C] <br>
		+	The start of ORF YKR005C was moved upstream 303 nt from 449507 to 449810, and an intron was added at new relative coordinates 148-216, based on Miura et al. 2006. <br> <br>
		+	'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
		+	[https://www.yeastgenome.org/reference/S000119659 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] \| [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
		+	\|-
		+	\| 2007-04-04
		+	\| [https://www.yeastgenome.org/locus/YKL186C YKL186C] <br>
		+	MTR2/YKL186C mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version. <br> <br>
		+	'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
		+	[https://www.yeastgenome.org/reference/S000119659 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] \| [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
		+	\|-
		+	\| 2007-04-04
		+	\| [https://www.yeastgenome.org/locus/YKL150W YKL150W] <br>
		+	MCR1/YKL150W mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version. <br> <br>
		+	'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
		+	[https://www.yeastgenome.org/reference/S000119659 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] \| [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
		+	'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7.
		+	<br>
		+	[https://www.yeastgenome.org/reference/S000120506 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] \| [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>

← Older revision		Revision as of 22:07, 1 October 2019
Line 962:		Line 962:
	'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America. <br>		'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America. <br>
	[https://www.yeastgenome.org/reference/S000076263 SGD paper]		[https://www.yeastgenome.org/reference/S000076263 SGD paper]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 1999-03-12
		+	\| [https://www.yeastgenome.org/locus/YKL201C YKL201C], [https://www.yeastgenome.org/locus/YKL202W YKL202W]
		+	\| 64287
		+	\| 64287
		+	\| Substitution
		+	\| C
		+	\| T
		+	\|-
		+	\| \|\| colspan="6" \| MIPS made a correction to YKL202W, that also affects overlapping ORF MNN4/YKL201C: the C at chromosomal coordinate 64287 was changed to a T.
		+	<pre>Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320</pre>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| rowspan="3"\| 1999-03-12
		+	\| rowspan="3"\| [https://www.yeastgenome.org/locus/YKL201C YKL201C]
		+	\| 67457
		+	\| 67457
		+	\| Insertion
		+	\|
		+	\| T
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 65761
		+	\| 65761
		+	\| Deletion
		+	\| T
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 65689
		+	\| 65689
		+	\| Deletion
		+	\| A
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| MIPS made corrections in the area covering MNN4/YKL201C which resulted in the removal of YKL200C. MNN4/YKL201C now encompasses both ORFs plus additional sequence (coordinates 67463-63927). ''The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927''.
		+	<pre>Deletion of the A at 65689
		+
		+	Old: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTGACTAGCTAGACC 65700
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|
		+	New: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTG-CTAGCTAGACC 65699
		+
		+	Deletion of the T at 65761
		+	Old: 65751 TATTGTTTTTTACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65800
		+	\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 65750 TATTGTTTTT-ACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65798
		+
		+	Insertion of a T after the T at 67457
		+	Old: 67440 GTGAAGTTTAGATGATAT-CGCTGAAGCATAACTAATTAGTTTATTTGTG 67488
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 67434 GTGAAGTTTAGATGATATTCGCTGAAGCATAACTAATTAGTTTATTTGTG 67483</pre>
		+	'''Odani T, et al.''' (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10. <br>
		+	[https://www.yeastgenome.org/reference/S000049636 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9023541 PubMed] \| [https://academic.oup.com/glycob/article/6/8/805/588108 Full-Text] <br>
		+	'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America. <br>
		+	[https://www.yeastgenome.org/reference/S000076263 SGD paper]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| rowspan="2"\| 1999-03-12
		+	\| rowspan="2"\| [https://www.yeastgenome.org/locus/YKL198C YKL198C], [https://www.yeastgenome.org/locus/YKL199C YKL199C]
		+	\| 69101
		+	\| 69101
		+	\| Insertion
		+	\|
		+	\| G
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 68863
		+	\| 68863
		+	\| Insertion
		+	\|
		+	\| C
		+	\|-
		+	\| \|\| colspan="6" \| MIPS made corrections in the area covering PTK1/YKL198C and YKT9/YKL199C.
		+	<pre>Insertion of a C after the C at 68861
		+
		+	Old: 68819 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGC-GCGATTGCGGAATGCG 68877
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 68814 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGCCGCGATTGCGGAATGCG 68873
		+
		+	Insertion of a G after the G at 69100
		+	Old: 69058 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCG-CGAGCCGATCATCCCT 69116
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113</pre>

← Older revision		Revision as of 20:57, 1 October 2019
Line 883:		Line 883:
	'''Stoler S, et al.''' (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86. <br>		'''Stoler S, et al.''' (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86. <br>
	[https://www.yeastgenome.org/reference/S000046262 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/7698647 PubMed] \| [http://genesdev.cshlp.org/content/9/5/573 Full-Text] <br>		[https://www.yeastgenome.org/reference/S000046262 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/7698647 PubMed] \| [http://genesdev.cshlp.org/content/9/5/573 Full-Text] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2001-05-31
		+	\| [https://www.yeastgenome.org/locus/YKL201C YKL201C], [https://www.yeastgenome.org/locus/YKL202W YKL202W]
		+	\| 64287
		+	\| 64287
		+	\| Substitution
		+	\| T
		+	\| C
		+	\|-
		+	\| \|\| colspan="6" \| SGD received a direct notification from MIPS about the following sequence change. The nucleotide at coordinate 64287 was changed from T to C, altering translation of YKL202W by changing amino acid 157 from a Phe (TTT) to a Ser (TCT). This change also affects overlapping ORF MNN4/YKL201C. ''Note that this is the exact reciprocal of the sequence change made to this nucleotide on 1998-11-10.''
		+	<pre>Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320</pre>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| rowspan="6"\| 2011-02-03
		+	\| rowspan="6"\| [https://www.yeastgenome.org/locus/YKL200C YKL200C], [https://www.yeastgenome.org/locus/YKL201C YKL201C]
		+	\| 66685
		+	\| 66685
		+	\| Deletion
		+	\| T
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 66715
		+	\| 66715
		+	\| Deletion
		+	\| T
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 65922
		+	\| 65922
		+	\| Deletion
		+	\| A
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 66278
		+	\| 66278
		+	\| Deletion
		+	\| T
		+	\|
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 66298
		+	\| 66298
		+	\| Insertion
		+	\|
		+	\| G
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 66725
		+	\| 66725
		+	\| Deletion
		+	\| T
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| MIPS made sequence corrections in the area covering YKL200C that resulted in its subsumption into MNN4/YKL201C, which now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.
		+	<pre>Deletion of the A at 65922
		+
		+	Old: 65871 GGGCATTTGCAAGTCGAAATCGTTATCCCAAAGGGAAAGCCATTCCATTG 65940
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 65869 GGGCATTTGCAAGTCGAAATCGTTATCCCAA-GGGAAAGCCATTCCATTG 65937
		+
		+	Deletion of the T at 66278, insertion of a G after the G at 66298
		+	Old: 66231 CTAACTCTTCAATTTTTTTGGAGGCATTCGAACTTGAAATCCGAAGGG-A 66299
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|
		+	New: 66228 CTAACTCTTCAATTTTTTTGGAGGCAT-CGAACTTGAAATCCGAAGGGGA 66296
		+
		+	Deletion of the T at 66685, deletion of the T at 66715
		+	Old: 66650 GTATTAAATCTTAAATCCCTTAGGAGAGCCATGCCCGTCTGGAGTTGAAT 66719
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|
		+	New: 66647 GTATTAAATCTTAAA-CCCTTAGGAGAGCCATGCCCGTCTGGAGT-GAAT 66714
		+
		+	Deletion of the T at 66725
		+	Old: 66720 AGCTTTGGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66769
		+	\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 66715 AGCTT-GGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66763</pre>
		+	'''Odani T, et al.''' (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10. <br>
		+	[https://www.yeastgenome.org/reference/S000049636 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9023541 PubMed] \| [https://academic.oup.com/glycob/article/6/8/805/588108 Full-Text] <br>
		+	'''Cherry JM, et al.''' (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America. <br>
		+	[https://www.yeastgenome.org/reference/S000076263 SGD paper]

← Older revision		Revision as of 20:51, 1 October 2019
Line 777:		Line 777:
	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>		'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>		[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2004-02-13
		+	\| [https://www.yeastgenome.org/locus/YKL203C YKL203C]
		+	\| 58941
		+	\| 58941
		+	\| Insertion
		+	\|
		+	\| CCG
		+	\|-
		+	\| \|\| colspan="6" \| Insertion of three nucleotides was confirmed by sequencing genomic DNA from BY4743 (which is derived from S288C). This is in agreement with GenBank accession X71416, which is the sequence of YKL203C from JK9-3da. ''Personal communication from Vik Anand (vik@ucla.edu)''.
		+	<pre>New: 58925 CCAAACCCCAGGCAGCGCCGGCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58984
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old: 58925 CCAAACCCCAGGCAGCG---GCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58981</pre>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2004-02-12
		+	\| [https://www.yeastgenome.org/locus/YKL033W-A YKL033W-A]
		+	\| 374308
		+	\| 374308
		+	\| Insertion
		+	\|
		+	\| G
		+	\|-
		+	\| \|\| colspan="6" \| Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 374308 in YKL033W-A. As a consequence of this sequence change, YKL033W-A was extended at the 3' end, increasing the size of the predicted protein from 60 amino acids to 236 amino acids.
		+	<pre>New: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCGGAAGCAGGAAAAAGGGTGATCGAACACT 374336
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCG-AAGCAGGAAAAAGGGTGATCGAACACT 374335</pre>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2004-02-11
		+	\| [https://www.yeastgenome.org/locus/YKR056W YKR056W]
		+	\| 550828
		+	\| 550828
		+	\| Insertion
		+	\|
		+	\| A
		+	\|-
		+	\| \|\| colspan="6" \| Brachat et al. 2003 predicted and confirmed the insertion of a single A nucleotide after the A at chromosomal coordinate 550828 in YKR056W. As a consequence of this sequence change, YKR056W was extended in the 3' end, increasing the size of the predicted protein from 617 to 639 amino acids.
		+	<pre>New: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATAATCCAGCCAAGATTATTTACATATCGTGT 550857
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATA-TCCAGCCAAGATTATTTACATATCGTGT 550856</pre>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2004-02-11
		+	\| [https://www.yeastgenome.org/locus/YKR099C-A YKR099C-A], [https://www.yeastgenome.org/locus/YKR100C YKR100C]
		+	\| 638899
		+	\| 638899
		+	\| Insertion
		+	\|
		+	\| G
		+	\|-
		+	\| \|\| colspan="6" \| Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at 638899 in YKR100C. As a consequence of this sequence change, YKR099C-A was merged into YKR100C. YKR100C was extended in the 3' end, increasing the size of the predicted protein from 241 amino acids to 355 amino acids.
		+	<pre>New: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGGGTAATACGAACCAAAGTCCTG 638920
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGG-TAATACGAACCAAAGTCCTG 638919</pre>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2003-01-10
		+	\| [https://www.yeastgenome.org/locus/YKL049C YKL049C]
		+	\| 346324
		+	\| 346324
		+	\| Substitution
		+	\| G
		+	\| C
		+	\|-
		+	\| \|\| colspan="6" \| The G inserted after the G at 346324 three days ago was changed to a C.
		+	<pre>Old: 346321 CTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380
		+	\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 346321 CTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380</pre>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2003-01-08
		+	\| [https://www.yeastgenome.org/locus/YKL198C YKL198C], [https://www.yeastgenome.org/locus/YKL199C YKL199C]
		+	\| 69156
		+	\| 69156
		+	\| Deletion
		+	\| G
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| Due to the deletion of the G at coordinate 69156 on Chromosome XI, YKL198C and YKL199C have been merged into one single ORF - PTK1/YKL198C - encoding a protein of 649 amino acids (1950 nucleotides). The new start and stop coordinates of PTK1/YKL198C are 70219 and 68270, respectively. The names YKT9 and YKL199C are being retained as aliases. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. ''We thank Gerard Manning (gerard-manning@sugen.com) for reporting this sequence error on Chromosome XI to SGD''.
		+	<pre>Old: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTGGTGGTACCAGTCTGAGATACCAAAA 69180
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTG-TGGTACCAGTCTGAGATACCAAAA 69179</pre>
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2003-01-07
		+	\| [https://www.yeastgenome.org/locus/YKL049C YKL049C]
		+	\| 346324
		+	\| 346324
		+	\| Insertion
		+	\|
		+	\| G
		+	\|-
		+	\| \|\| colspan="6" \| Due to the insertion of a G after the G at 346324, the coordinates of CSE4/YKL049C have been changed from 346130-345717 to 346406-345717, extending the ORF from 414 bp in length to 690 bp. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. ''Thanks to Sam Stoler, Judith Sharp, Vivian Measday, Sue Biggins, and Kelcy Newell for reporting this sequence error on Chromosome XI to SGD.''
		+	<pre>Old: 346321 CCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379
		+	\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	New: 346320 CCTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379</pre>
		+	'''Stoler S, et al.''' (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86. <br>
		+	[https://www.yeastgenome.org/reference/S000046262 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/7698647 PubMed] \| [http://genesdev.cshlp.org/content/9/5/573 Full-Text] <br>