Chromosome XIII History - Revision history

Stacia at 22:09, 21 April 2022

2022-04-21T22:09:47Z

Stacia: /* Annotation Changes without sequence changes */

2022-04-21T22:02:26Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T19:44:26Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T19:39:41Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T19:36:23Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T19:27:59Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-10-02T19:25:24Z

‎Annotation Changes without sequence changes

Sage at 17:42, 2 October 2019

2019-10-02T17:42:58Z

Sage: /* Sequence Changes */

2019-10-02T17:16:38Z

‎Sequence Changes

Sage: /* Sequence Changes */

2019-10-02T17:15:42Z

‎Sequence Changes

@@ Line 1: / Line 1: @@
 This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31. <br>
 *The sequence of Chromosome XIII has been updated '''13''' times, affecting '''16''' features. <br>
-*The annotation of Chromosome XIII has been updated '''32''' times, affecting '''70''' features. <br>
+*The annotation of Chromosome XIII has been updated '''35''' times, affecting '''73''' features. <br>
 *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

@@ Line 197: / Line 197: @@
 {| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
 ! Date  !! Affected Features
 |-
 | 2014-11-19

← Older revision		Revision as of 19:44, 2 October 2019
Line 388:		Line 388:
	'''Adzuma K, et al.''' (1984) Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol Cell Biol 4(12):2735-44. <br>		'''Adzuma K, et al.''' (1984) Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol Cell Biol 4(12):2735-44. <br>
	[https://www.yeastgenome.org/reference/S000040866 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/6098821 PubMed] \| [https://mcb.asm.org/content/4/12/2735.long Full-Text]<br>		[https://www.yeastgenome.org/reference/S000040866 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/6098821 PubMed] \| [https://mcb.asm.org/content/4/12/2735.long Full-Text]<br>
		+	\|-
		+	\| 1999-11-17
		+	\| [https://www.yeastgenome.org/locus/YMR125W YMR125W] <br>
		+	Two annotation changes were made to STO1/YMR125W based on Uemura et al. 1996: (1) The start was moved 331 bp upstream from chromosomal coordinate 517869 to 517538, and (2) a 322-bp intron was added at 517563-517884. The stop remains unmoved at 520445. The position for the intron relative to the ORF itself is 26-347, with the coding sequence now 1-25, 348-2908. ''Previous chromosomal coordinates were 517869-520445, representing a coding sequence with relative ORF coordinates of 1-2577''.<br><br>
		+	'''Uemura H, et al.''' (1996) Mutations in GCR3, a gene involved in the expression of glycolytic genes in Saccharomyces cerevisiae, suppress the temperature-sensitive growth of hpr1 mutants. Genetics 142(4):1095-103. <br>
		+	[https://www.yeastgenome.org/reference/S000046849 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/8846890 PubMed] \| [https://www.genetics.org/content/142/4/1095.long Full-Text] <br>
		+	\|-
		+	\| 1999-07-17
		+	\| [https://www.yeastgenome.org/locus/YML017W YML017W] <br>
		+	The original annotation of the YML017W ORF was incorrect because it did not include the stop codon. The stop coordinate has now been corrected so that the ORF extends an additional three nucleotides to include the stop codon.<br><br>
		+	\|-
		+	\| 1998-05-21
		+	\| [https://www.yeastgenome.org/locus/YML081C-A YML081C-A], [https://www.yeastgenome.org/locus/YMR046W-A YMR046W-A], [https://www.yeastgenome.org/locus/YMR158C-A YMR158C-A], [https://www.yeastgenome.org/locus/YMR194C-A YMR194C-A] <br>
		+	The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. <br><br>
		+	The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+
		+	\|}

← Older revision		Revision as of 19:39, 2 October 2019
Line 376:		Line 376:
	'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>		'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
	[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>		[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>
		+	\|-
		+	\| 2003-03-06
		+	\| [https://www.yeastgenome.org/locus/snR83 snR83]<br>
		+	Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.<br> <br>
		+	'''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28. <br>
		+	[https://www.yeastgenome.org/reference/S000074006 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] \| [https://academic.oup.com/nar/article/31/14/4119/2904330 Full-Text] <br>
		+	\|-
		+	\| 2003-01-07
		+	\| [https://www.yeastgenome.org/locus/YML032C YML032C] <br>
		+	The start site of RAD52/YML032C has been moved 99 nt downstream from 214029 to 213930. Chromosomal coordinates change from old:214029-212515 to new:213930-212515. Relative coordinates change from old:1-1515 to new:1-1416. In S. paradoxus, S. bayanus, and S. mikatae, the first in-frame ATG aligns with the third start codon in S. cerevisiae. This change is also supported by the following evidence: (1) mutational analysis by the Rothstein lab (A. Antunez de Mayolo, M. Lisby, N. Erdeniz); (2) additional sequence analysis done by Tanja Thybo Frederiksen in Uffe Mortensen's lab; (3) mRNA analysis described in Adzuma et al. <br> <br>
		+	'''Adzuma K, et al.''' (1984) Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol Cell Biol 4(12):2735-44. <br>
		+	[https://www.yeastgenome.org/reference/S000040866 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/6098821 PubMed] \| [https://mcb.asm.org/content/4/12/2735.long Full-Text]<br>

← Older revision		Revision as of 19:36, 2 October 2019
Line 339:		Line 339:
	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>		'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>		[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>
		+	\|-
		+	\| 2003-09-09
		+	\| [https://www.yeastgenome.org/locus/TEL13L TEL13L], [https://www.yeastgenome.org/locus/TEL13R TEL13R] <br>
		+	The chromosomal locations for TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, and TEL13R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). <br> <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YML100W-A YML100W-A], [https://www.yeastgenome.org/locus/YML133W-A YML133W-A], [https://www.yeastgenome.org/locus/YML133W-B YML133W-B], [https://www.yeastgenome.org/locus/YMR001C-A YMR001C-A], [https://www.yeastgenome.org/locus/YMR105W-A YMR105W-A], [https://www.yeastgenome.org/locus/YMR182W-A YMR182W-A], [https://www.yeastgenome.org/locus/YMR242W-A YMR242W-A], [https://www.yeastgenome.org/locus/YMR272W-A YMR272W-A], [https://www.yeastgenome.org/locus/YMR272W-B YMR272W-B], [https://www.yeastgenome.org/locus/YMR315W-A YMR315W-A] <br>
		+	Thanks to Kumar et al. for providing the coordinates of the following ORFs: YML100W-A, YML133W-B, YMR105W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A, YMR182W-A, YMR001C-A, and YML133W-A.<br> <br>
		+	'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
		+	[https://www.yeastgenome.org/reference/S000073673 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] \| [https://www.nature.com/articles/nbt0102-58 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] \| [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YML054C-A YML054C-A], [https://www.yeastgenome.org/locus/YMR030W-A YMR030W-A], [https://www.yeastgenome.org/locus/YMR141W-A YMR141W-A], [https://www.yeastgenome.org/locus/YMR230W-A YMR230W-A], [https://www.yeastgenome.org/locus/YMR268W-A YMR268W-A], [https://www.yeastgenome.org/locus/YMR307C-A YMR307C-A] <br>
		+	Thanks to Kessler et al. for providing the coordinates of the following Chromosome XIII ORFs: YML054C-A, YMR030W-A, YMR141W-A, YMR268W-A, YMR307C-A, and YMR230W-A.<br> <br>
		+	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
		+	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YMR194C-B YMR194C-B] <br>
		+	Thanks to Brachat et al. for providing the coordinates of YMR194C-B. <br> <br>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YML031C-A YML031C-A] <br>
		+	The ORF YML032C-A was included in the original annotation of Chromosome XIII, but was later withdrawn and was deleted from SGD on August 23, 1999. On the recommendation of MIPS, this ORF has subsequently added back to the genome annotation, but with a new name (YML031C-A). Thanks to MIPS for providing the coordinates of YML031C-A. <br> <br>
		+	'''SGD (2007)''' Information without a citation in SGD <br>
		+	\|-
		+	\| 2003-07-29
		+	\| [https://www.yeastgenome.org/locus/YMR013C-A YMR013C-A], [https://www.yeastgenome.org/locus/YMR175W-A YMR175W-A], [https://www.yeastgenome.org/locus/YMR247W-A YMR247W-A] <br>
		+	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIII ORFs: YMR013C-A, YMR175W-A, and YMR247W-A.<br> <br>
		+	'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9. <br>
		+	[https://www.yeastgenome.org/reference/S000042214 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] \| [https://mcb.asm.org/content/19/10/7041.long Full-Text] <br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+	'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
		+	[https://www.yeastgenome.org/reference/S000073672 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] \| [https://genome.cshlp.org/content/12/8/1210.long Full-Text] \| [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>

@@ Line 325: / Line 325: @@
 | [https://www.yeastgenome.org/locus/YML107C YML107C] <br>
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YML107C be moved 156 nt (52 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) In S. paradoxus and S. mikatae, the original upstream start is not conserved, and there are frameshifts between the two ATGs. The upstream start codon is conserved in S. bayanus, but there are frameshifts between the two ATGs. <br> <br>
 '''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
 [https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
 '''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
 [https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>

← Older revision		Revision as of 17:42, 2 October 2019
Line 189:		Line 189:
	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>		'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>		[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>
		+
		+	\|}
		+
		+	<br><br>
		+
		+	=Annotation Changes ''without sequence changes''=
		+	{\| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
		+	! Date !! Affected Features
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1304 ARS1304], [https://www.yeastgenome.org/locus/ARS1307 ARS1307], [https://www.yeastgenome.org/locus/ARS1307.5 ARS1307.5], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1309 ARS1309], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1316 ARS1316], [https://www.yeastgenome.org/locus/ARS1320 ARS1320], [https://www.yeastgenome.org/locus/ARS1323 ARS1323], [https://www.yeastgenome.org/locus/ARS1325 ARS1325], [https://www.yeastgenome.org/locus/ARS1327 ARS1327], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1330 ARS1330], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br>
		+	As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome XIII based on Liachko et al. 2013: ARS1304, ARS1307, ARS1307.5, ARS1308, ARS1309, ARS1312, ARS1316, ARS1320, ARS1323, ARS1325, ARS1327, ARS1329, ARS1330, ARS1332. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1303 ARS1303], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1310 ARS1310], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1324 ARS1324], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br>
		+	The chromosomal coordinates of the following ARS elements on Chromosome XIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS1303, ARS1308, ARS1310, ARS1312, ARS1324, ARS1329, ARS1332. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS1307.5 ARS1307.5] <br>
		+	ARS1307.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. <br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ZOD1 ZOD1] <br>
		+	ZOD1 was added to genome annotation and assigned chromosomal coordinates based on Guffanti et al. 2006 as part of SGD's genome annotation revision R64.2. <br> <br>
		+	'''Guffanti E, et al.''' (2006) Nucleosome Depletion Activates Poised RNA Polymerase III at Unconventional Transcription Sites in Saccharomyces cerevisiae. J Biol Chem 281(39):29155-64. <br>
		+	[https://www.yeastgenome.org/reference/S000117010 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16816405 PubMed] \| [http://www.jbc.org/content/281/39/29155.long Full-Text] <br>
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ETC5 ETC5] <br>
		+	ETC5 was added to the genome annotation as a nuclear matrix attachment site based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2. <br> <br>
		+	'''Hiraga SI, et al.''' (2012) FIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54. <br>
		+	[https://www.yeastgenome.org/reference/S000149071 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] \| [https://www.molbiolcell.org/doi/10.1091/mbc.e11-04-0365 Full-Text]<br>
		+	\|-
		+	\| 2009-05-08
		+	\| [https://www.yeastgenome.org/locus/ARS1304 ARS1304], [https://www.yeastgenome.org/locus/ARS1317 ARS1317], [https://www.yeastgenome.org/locus/ARS1319 ARS1319], [https://www.yeastgenome.org/locus/ARS1321 ARS1321], [https://www.yeastgenome.org/locus/ARS1322 ARS1322], [https://www.yeastgenome.org/locus/ARS1331 ARS1331], [https://www.yeastgenome.org/locus/ARS1333 ARS1333], [https://www.yeastgenome.org/locus/ARS1335 ARS1335] <br>
		+	The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335. <br> <br>
		+	'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39. <br>
		+	[https://www.yeastgenome.org/reference/S000117571 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] \| [https://www.embopress.org/cgi/doi/10.1038/sj.emboj.7601251 Full-Text]<br>
		+	\|-
		+	\| 2007-07-10
		+	\| [https://www.yeastgenome.org/locus/YMR242C YMR242C] <br>
		+	The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa). <br> <br>
		+	'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
		+	[https://www.yeastgenome.org/reference/S000119659 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] \| [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
		+	'''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9. <br>
		+	[https://www.yeastgenome.org/reference/S000121920 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] \| [https://genome.cshlp.org/content/17/4/503 Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb]<br>
		+	\|-
		+	\| 2007-07-10
		+	\| [https://www.yeastgenome.org/locus/YML036W YML036W] <br>
		+	The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa). <br> <br>
		+	'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51. <br>
		+	[https://www.yeastgenome.org/reference/S000119659 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] \| [https://www.pnas.org/content/103/47/17846.long Full-Text] <br>
		+	'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7. <br>
		+	[https://www.yeastgenome.org/reference/S000120506 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/17244705 PubMed] \| [https://www.pnas.org/content/104/5/1522.long Full-Text] <br>
		+	\|-
		+	\| 2007-07-10
		+	\| [https://www.yeastgenome.org/locus/snR78 snR78] <br>
		+	Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt. <br> <br>
		+	'''Qu LH, et al.''' (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast. Mol Cell Biol 19(2):1144-58. <br>
		+	[https://www.yeastgenome.org/reference/S000041297 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9891049 PubMed] \| [https://mcb.asm.org/content/19/2/1144 Full-Text] <br>
		+	\|-
		+	\| 2006-10-05
		+	\| [https://www.yeastgenome.org/locus/snR86 snR86] <br>
		+	This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene. <br> <br>
		+	'''Torchet C, et al.''' (2005) The complete set of H/ACA snoRNAs that guide rRNA pseudouridylations in Saccharomyces cerevisiae. RNA 11(6):928-38. <br>
		+	[https://www.yeastgenome.org/reference/S000081894 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/15923376 PubMed] \| [https://rnajournal.cshlp.org/content/11/6/928.long Full-Text] <br>
		+	\|-
		+	\| 2006-09-07
		+	\| [https://www.yeastgenome.org/locus/ARS1303 ARS1303], [https://www.yeastgenome.org/locus/ARS1305 ARS1305], [https://www.yeastgenome.org/locus/ARS1307 ARS1307], [https://www.yeastgenome.org/locus/ARS1308 ARS1308], [https://www.yeastgenome.org/locus/ARS1309 ARS1309], [https://www.yeastgenome.org/locus/ARS1310 ARS1310], [https://www.yeastgenome.org/locus/ARS1312 ARS1312], [https://www.yeastgenome.org/locus/ARS1316 ARS1316], [https://www.yeastgenome.org/locus/ARS1320 ARS1320], [https://www.yeastgenome.org/locus/ARS1323 ARS1323], [https://www.yeastgenome.org/locus/ARS1324 ARS1324], [https://www.yeastgenome.org/locus/ARS1325 ARS1325], [https://www.yeastgenome.org/locus/ARS1327 ARS1327], [https://www.yeastgenome.org/locus/ARS1328 ARS1328], [https://www.yeastgenome.org/locus/ARS1329 ARS1329], [https://www.yeastgenome.org/locus/ARS1330 ARS1330], [https://www.yeastgenome.org/locus/ARS1332 ARS1332] <br>
		+	The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332. <br> <br>
		+	'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9. <br>
		+	[https://www.yeastgenome.org/reference/S000117321 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed] \| [http://genesdev.cshlp.org/content/20/14/1874.long Full-Text] \| [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement]<br>
		+	\|-
		+	\| 2006-05-10
		+	\| [https://www.yeastgenome.org/locus/YMR059W YMR059W] <br>
		+	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream. <br> <br>
		+	'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
		+	[https://www.yeastgenome.org/reference/S000073327 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] \| [https://www.nature.com/articles/nature01644 Full-Text] \| [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
		+	'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
		+	[https://www.yeastgenome.org/reference/S000073948 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] \| [https://science.sciencemag.org/content/301/5629/71.long Full-Text] \| [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement]<br>

@@ Line 64: / Line 64: @@
 |- style="height:30px; width:30px; text-align:center;"
 | 908216
 | 908216
 | T
 | C

← Older revision		Revision as of 17:15, 2 October 2019
Line 75:		Line 75:
	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>		'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]		[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YMR262W YMR262W]
		+	\| 794225
		+	\| 794225
		+	\| Substitution
		+	\| G
		+	\| C
		+	\|-
		+	\| \|\| colspan="6" \| Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.
		+	<pre>New 794220 ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794279
		+	\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 794219 ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA 794278</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YMR008C YMR008C], [https://www.yeastgenome.org/locus/YMR009W YMR009W]
		+	\| 283468
		+	\| 283468
		+	\| Insertion
		+	\|
		+	\| G
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W.
		+	<pre>New 283440 GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG 283499
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 283440 GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG 283498</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YML131W YML131W], [https://www.yeastgenome.org/locus/YML132W YML132W]
		+	\| 9542
		+	\| 9542
		+	\| Deletion
		+	\| T
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W.
		+	<pre>New 9531 TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9599
		+	\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 9531 TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC 9600</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YMRCtau3 YMRCtau3], [https://www.yeastgenome.org/locus/YMRWdelta20 YMRWdelta20]
		+	\| 808976
		+	\| 808976
		+	\| Substitution
		+	\| A
		+	\| T
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
		+	<pre>New 808920 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC 808989
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 808919 TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC 808988</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YML121W YML121W], [https://www.yeastgenome.org/locus/YML122C YML122C]
		+	\| 26602
		+	\| 26602
		+	\| Insertion
		+	\|
		+	\| T
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
		+	<pre>New 26580 TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 26581 TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA 26639</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2011-02-03
		+	\| [https://www.yeastgenome.org/locus/YMR315W-A YMR315W-A], [https://www.yeastgenome.org/locus/YMR316W YMR316W]
		+	\| 904639
		+	\| 904639
		+	\| Insertion
		+	\|
		+	\| G
		+	\|-
		+	\| \|\| colspan="6" \| A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W.
		+	<pre>New 904620 TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904679
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
		+	Old 904619 TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG 904677</pre>
		+	'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. <br>
		+	[http://www.yeastgenome.org/reference/24374639/overview SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] \| [http://g3journal.org/content/4/3/389 Full-Text]
		+
		+	\|- style="height:30px; width:30px; text-align:center;"
		+	\| 2004-02-28
		+	\| [https://www.yeastgenome.org/locus/YMR268W-A YMR268W-A], [https://www.yeastgenome.org/locus/YMR269W YMR269W]
		+	\| 804684
		+	\| 804684
		+	\| Deletion
		+	\| C
		+	\|
		+	\|-
		+	\| \|\| colspan="6" \| Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF.
		+	<pre>New: 181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239
		+	\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|
		+	Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694</pre>
		+	'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
		+	[https://www.yeastgenome.org/reference/S000073670 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] \| [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>
		+	'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
		+	[https://www.yeastgenome.org/reference/S000073671 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] \| [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>