Chromosome IX History - Revision history

Sage at 15:58, 1 October 2019

2019-10-01T15:58:22Z

Sage: /* Annotation Changes without sequence changes */

2019-09-30T22:30:11Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-09-30T22:26:38Z

‎Annotation Changes without sequence changes

Show changes

Sage: /* Annotation Changes without sequence changes */

2019-09-30T21:44:39Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-09-30T21:38:34Z

‎Annotation Changes without sequence changes

Sage: /* Annotation Changes without sequence changes */

2019-09-30T21:35:48Z

‎Annotation Changes without sequence changes

Sage: Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.
*The se..."

2019-09-30T21:29:07Z

Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31. *The se..."

New page

This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31. 
*The sequence of Chromosome VII has been updated '''9''' times, affecting '''12''' features. 
*The annotation of Chromosome VII has been updated '''232''' times, affecting '''63''' features. 
*Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

__FORCETOC__

=Sequence Changes=

{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
! Date !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence
|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/tK(CUU)I tK(CUU)I]
| 300235
| 300235
| Insertion
|
| G
|-
| || colspan="6" | A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer.
<pre>New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIL012W YIL012W]
| 333321
| 333321
| Insertion
|
| C
|-
| || colspan="6" | A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
<pre>New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YIL123W YIL123W]
| 128409
| 128409
| Insertion
|
| CT
|- style="height:30px; width:30px; text-align:center;"
| 128403
| 128403
| Insertion
|
| C
|-
| || colspan="6" | Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
<pre>New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIL083C YIL083C]
| 203638
| 203638
| Substitution
| A
| C
|-
| || colspan="6" | A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
<pre>New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIR039C YIR039C], [https://www.yeastgenome.org/locus/YIRCdelta6 YIRCdelta6]
| 427189
| 427189
| Insertion
|
| A
|-
| || colspan="6" | A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
<pre>New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIL051C YIL051C], [https://www.yeastgenome.org/locus/YIL052C YIL052C]
| 257479
| 257479
| Deletion
| A
|
|-
| || colspan="6" | A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C.
<pre>New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIR041W YIR041W], [https://www.yeastgenome.org/locus/YIR042C YIR042C]
| 435029
| 435029
| Deletion
| G
|
|-
| || colspan="6" | A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C.
<pre>New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YIL056W YIL056W], [https://www.yeastgenome.org/locus/tS(UGA)I tS(UGA)I]
| 249623
| 249623
| Deletion
| T
|
|-
| || colspan="6" | A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W.
<pre>New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657</pre>
'''Engel SR, et al.''' (2014) The Reference Genome Sequence of ''Saccharomyces cerevisiae'': Then and Now. G3 (Bethesda) Mar 20;4(3):389-98. 
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|}

 

=Annotation Changes ''without sequence changes''=
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
! Date !! Affected Features

@@ Line 1: / Line 1: @@
 This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31. <br>
-*The sequence of Chromosome VII has been updated '''9''' times, affecting '''12''' features. <br>
+*The sequence of Chromosome IX has been updated '''9''' times, affecting '''12''' features. <br>
-*The annotation of Chromosome VII has been updated '''232''' times, affecting '''63''' features. <br>
+*The annotation of Chromosome IX has been updated '''232''' times, affecting '''63''' features. <br>
 *Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

← Older revision		Revision as of 22:30, 30 September 2019
Line 371:		Line 371:
	\| [https://www.yeastgenome.org/locus/ARS913 ARS913] <br>		\| [https://www.yeastgenome.org/locus/ARS913 ARS913] <br>
	Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. <br><br>		Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan. <br><br>
		+
		+	\|-
		+	\| 1999-11-17
		+	\| [https://www.yeastgenome.org/locus/YIL106W YIL106W] <br>
		+	Spingola et al. 1999 identified an intron in YIL106W that was not previously annotated, and also identified a different start codon. The intron has been added, and the start shifted upstream. The old chromosomal coordinates for YIL106W were 166731-167441 (coding 1-711). The new chromosomal coordinates are 166412-167441 (coding 1-20..106-1030). <br><br>
		+	'''Spingola M, et al.''' (1999) Genome-wide bioinformatic and molecular analysis of introns in Saccharomyces cerevisiae. RNA 5(2):221-34. <br>
		+	[https://www.yeastgenome.org/reference/S000064707 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/10024174 PubMed] \| [https://rnajournal.cshlp.org/content/5/2/221.long Full-Text] <br>
		+
		+	\|-
		+	\| 1998-05-21
		+	\| [https://www.yeastgenome.org/locus/YIR020W-A YIR020W-A] <br>
		+	The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.
		+	<br><br>
		+	The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.<br><br>
		+	'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
		+	[https://www.yeastgenome.org/reference/S000058021 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] \| [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
		+
		+	\|}

← Older revision		Revision as of 21:44, 30 September 2019
Line 178:		Line 178:
	'''Harrison P, et al.''' (2002) A small reservoir of disabled ORFs in the yeast genome and its implications for the dynamics of proteome evolution. J Mol Biol 316(3):409-19. <br>		'''Harrison P, et al.''' (2002) A small reservoir of disabled ORFs in the yeast genome and its implications for the dynamics of proteome evolution. J Mol Biol 316(3):409-19. <br>
	[https://www.yeastgenome.org/reference/S000069218 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11866506 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0022283601953434?via%3Dihub Full-Text]		[https://www.yeastgenome.org/reference/S000069218 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11866506 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0022283601953434?via%3Dihub Full-Text]
		+
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/YIL167W YIL167W], [https://www.yeastgenome.org/locus/YIL168W YIL168W] <br>
		+	As part of SGD's genome annotation revision R64.2, the annotations of SDL1/YIL167W and YIL168W, which were previously annotated as adjacent pseudogenes, have been changed. They were merged into a single blocked reading frame, keeping the name SDL1/YIL167W. YIL168W is being retained as an alias.<br> <br>
		+	'''Seufert W, et al.''' (1990) Nucleotide sequence of the yeast SDH1 gene encoding a serine dehydratase homolog. Nucleic Acids Res 18(12):3653. <br>
		+	[https://www.yeastgenome.org/reference/S000065076 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/2194168 PubMed] \| [https://academic.oup.com/nar/article/18/12/3653/1082394 Full-Text]
		+
		+	\|-
		+	\| 2013-08-14
		+	\| [https://www.yeastgenome.org/locus/YIL080W YIL080W] <br>
		+	YIL080W was included in the original annotation in error and was later withdrawn because it overlaps completely with functional transposable element gene YIL082W-A. It was annotated with the same start as YIL082W-A, but with a different stop codon 225 bp downstream, resulting in an incorrectly appended C-terminus containing internal stops.<br> <br>
		+
		+	\|-
		+	\| 2010-01-05
		+	\| [https://www.yeastgenome.org/locus/PWR1 PWR1] <br>
		+	New ncRNA PWR1 was added to the genome annotation based on Bumgarner et al. 2009.<br> <br>
		+	'''Bumgarner SL, et al.''' (2009) Toggle involving cis-interfering noncoding RNAs controls variegated gene expression in yeast. Proc Natl Acad Sci U S A 106(43):18321-6. <br>
		+	[https://www.yeastgenome.org/reference/S000131891 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/19805129 PubMed] \| [https://www.pnas.org/content/106/43/18321.long Full-Text] \| [https://www.yeastgenome.org/reference/S000148588 Comments & Errata] \| [https://www.yeastgenome.org/reference/S000134746 Comments & Errata]

← Older revision		Revision as of 21:38, 30 September 2019
Line 171:		Line 171:
	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>		'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]		[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/YIR043C YIR043C], [https://www.yeastgenome.org/locus/YIR044C YIR044C] <br>
		+	The annotations of YIR043C and YIR044C, which were previously annotated as adjacent pseudogenes, have been changed as part of SGD's genome annotation revision R64.2. They were merged into a single blocked reading frame, keeping the name YIR043C. YIR044C is being retained as an alias.<br> <br>
		+	'''Harrison P, et al.''' (2002) A small reservoir of disabled ORFs in the yeast genome and its implications for the dynamics of proteome evolution. J Mol Biol 316(3):409-19. <br>
		+	[https://www.yeastgenome.org/reference/S000069218 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/11866506 PubMed] \| [https://www.sciencedirect.com/science/article/pii/S0022283601953434?via%3Dihub Full-Text]

← Older revision		Revision as of 21:35, 30 September 2019
Line 151:		Line 151:
	{\| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"		{\| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
	! Date !! Affected Features		! Date !! Affected Features
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS911 ARS911], [https://www.yeastgenome.org/locus/ARS912 ARS912], [https://www.yeastgenome.org/locus/ARS913 ARS913], [https://www.yeastgenome.org/locus/ARS914 ARS914], [https://www.yeastgenome.org/locus/ARS920 ARS920], [https://www.yeastgenome.org/locus/ARS922 ARS922], [https://www.yeastgenome.org/locus/ARS923 ARS923]<br>
		+	As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IX based on Liachko et al. 2013: ARS911, ARS912, ARS913, ARS923, ARS914, ARS920, ARS922.<br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS909 ARS909], [https://www.yeastgenome.org/locus/ARS913 ARS913], [https://www.yeastgenome.org/locus/ARS914 ARS914], [https://www.yeastgenome.org/locus/ARS919 ARS919], [https://www.yeastgenome.org/locus/ARS922 ARS922], [https://www.yeastgenome.org/locus/ARS923 ARS923]<br>
		+	The chromosomal coordinates of the following ARS elements on Chromosome IX were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS909, ARS913, ARS923, ARS914, ARS919, ARS922.<br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]
		+
		+	\|-
		+	\| 2014-11-19
		+	\| [https://www.yeastgenome.org/locus/ARS909 ARS907] <br>
		+	ARS907 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2.<br> <br>
		+	'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
		+	[https://www.yeastgenome.org/reference/S000152760 SGD paper] \| [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] \| [https://genome.cshlp.org/content/23/4/698 Full-Text]

Chromosome IX History - Revision history

Sage at 15:58, 1 October 2019

Sage: /* Annotation Changes without sequence changes */

Sage: /* Annotation Changes without sequence changes */

Sage: /* Annotation Changes without sequence changes */

Sage: /* Annotation Changes without sequence changes */

Sage: /* Annotation Changes without sequence changes */

Sage: Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31. *The se..."

Sage: Created page with "This page lists all sequence and annotation changes that have been made to the Chromosome IX systematic reference sequence since its intial release on 1996-07-31.
*The se..."