View source for Chromosome IV History



This page lists all sequence and annotation changes that have been made to the Chromosome IV systematic reference sequence since its intial release on 1996-07-31.<br>
The sequence of Chromosome IV has been updated '''63''' times, affecting '''69''' features.<br>
The annotation of Chromosome IV has been updated '''63''' times, affecting '''111''' features.<br>
Current and past versions can be obtained from SGD's [https://www.yeastgenome.org/downloads Download site].

__FORCETOC__

=Sequence Changes=

{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
! Date  !! Affected Features !! Start Coordinate of Change !! End Coordinate of Change !! Type of Change !! Old Sequence !! New Sequence

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR215C YDR215C]
| 894308
| 894308
| Insertion
| 
| G
|-
| || colspan="6" | A single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer.
<pre>New    894294   GAATGATTGCCGAAAGGGCGGGCCCTAGTCAATGGCATCATGCGGGAACGTGCAGTAAAG  894353
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    894292   GAATGATTGCCGAAAGG-CGGGCCCTAGTCAATGGCATCATGCGGGAACGTGCAGTAAAG  894350</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2011-02-03
| rowspan="3"| [https://www.yeastgenome.org/locus/YDL190C YDL190C]
| 119470
| 119470
| Substitution
| G
| A
|- style="height:30px; width:30px; text-align:center;"
| 119564
| 119564
| Substitution
| T
| A
|- style="height:30px; width:30px; text-align:center;"
| 121289
| 121289
| Substitution
| G
| A
|-
| || colspan="6" | Two nucleotide substitutions in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid. A third nucleotide substitution did not affect the protein sequence.
<pre>New    119460   GCCCCTTGCACGATTATCCAGCTCATTTTGGATATTATGCACCTCAGCCAAATTACTTAG  119519
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    119461   GCCCCTTGCGCGATTATCCAGCTCATTTTGGATATTATGCACCTCAGCCAAATTACTTAG  119520</pre>

<pre>New    119520   GCCTTCATCCAACAGGAAAGTCAAGTCATTCAACATACGAGCAACGAACCTCACAAAAAA  119579
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    119521   GCCTTCATCCAACAGGAAAGTCAAGTCATTCAACATACGAGCATCGAACCTCACAAAAAA  119580</pre>

<pre>New    121260   ACCATTCATGCAAAAGTTTTCTATTTGTAAGGCAACGACACCATAGCCAATGACAAGACG  121319
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    121261   ACCATTCATGCAAAAGTTTTCTATTTGTGAGGCAACGACACCATAGCCAATGACAAGACG  121320</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR360W YDR360W]
| 1194955
| 1194955
| Insertion
| 
| C
|-
| || colspan="6" | A single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
<pre>New    1194953  GGCTAACGCCTACGGGTAATAGCCGGCCTTTGAAAATTTCGCGGCTGCAGCAAGTACGCA  1195012
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1194947  GGCTAACGC-TACGGGTAATAGCCGGCCTTTGAAAATTTCGCGGCTGCAGCAAGTACGCA  1195005</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR350C YDR350C]
| 1176395
| 1176395
| Insertion
| 
| C
|-
| || colspan="6" | A single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
<pre>New    1176353  TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTCCTTTTTCGTCTC  1176412
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    1176348  TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTC-TTTTTCGTCTC  1176406</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YDL028C YDL028C]
| 402651
| 402651
| Deletion
| C
| 
|- style="height:30px; width:30px; text-align:center;"
| 402661
| 402661
| Insertion
| 
| T
|-
| || colspan="6" | Nucleotide changes within the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE.
<pre>New    402627   AAATCAATTGAATCATAATCCGTATT-TCTCTTCGTTTCTTTAAAGTTTGTTTGGTGAGA  402685
                |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||
Old    402625   AAATCAATTGAATCATAATCCGTATTCTCTCTTCGTT-CTTTAAAGTTTGTTTGGTGAGA  402683</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YDR527W YDR527W]
| 1491667
| 1491667
| Substitution
| G
| C
|- style="height:30px; width:30px; text-align:center;"
| 1491661
| 1491661
| Substitution
| G
| A
|-
| || colspan="6" | Two nucleotide substitutions within the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG.
<pre>New    1491653  AAAAAGACGTGGAAGAAGAAGCAAAAACTAATGATGACGTCGATGATATCGCACCCTTAG  1491712
                ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||
Old    1491646  AAAAAGACGTGGAAGGAGAAGGAAAAACTAATGATGACGTCGATGATATCGCACCCTTAG  1491705</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR541C YDR541C]
| 1519663
| 1519663
| Substitution
| C
| G
|-
| || colspan="6" | A single nucleotide substitution within the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid.
<pre>New    1519673  GTTCTGCTTCTTCAAAATTTGGGCAGCAGTATCATGGACACTTTCGTGTAAACTTCTGAA  1519732
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1519658  GTTCTCCTTCTTCAAAATTTGGGCAGCAGTATCATGGACACTTTCGTGTAAACTTCTGAA  1519717</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL239C YDL239C]
| 30786
| 30786
| Substitution
| G
| A
|-
| || colspan="6" | A single nucleotide substitution within the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine.
<pre>New    30781    TATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA  30840
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    30781    TATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA  30840</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL237W YDL237W]
| 30786
| 30786
| Substitution
| G
| A
|-
| || colspan="6" | A single nucleotide substitution within the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid.
<pre>New    30781    TATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA  30840
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    30781    TATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAGGAAA  30840</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR505C YDR505C]
| 1457020
| 1457020
| Substitution
| C
| T
|-
| || colspan="6" | A single nucleotide substitution within the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid.
<pre>New    1456973  TTATCAAGTCTCTAAAATCATTTCTCTCCTCACAAACGTAGTAAAACGTTAATTTCTTTC  1457032
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    1456966  TTATCAAGTCTCTAAAATCATTTCTCTCCTCACAAACGTAGTAAAACGTTAATTCCTTTC  1457025</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL102W YDL102W]
| 277105
| 277106
| Substitution
| CG
| GC
|-
| || colspan="6" | Two nucleotide substitutions within the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV.
<pre>New    277080   AATTAGAGTCTACTTTTGAACAAGAGCTATCGCAAATGGAACATGATATGGCCGACCAAG  277139
                |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||
Old    277080   AATTAGAGTCTACTTTTGAACAAGACGTATCGCAAATGGAACATGATATGGCCGACCAAG  277139</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR414C YDR414C]
| 1296177
| 1296177
| Substitution
| C
| G
|-
| || colspan="6" | A single nucleotide substitution within the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine.
<pre>New    1296173  TCAATGGTTTTGCAAACGATGTCAACGTGTCAGAGATTAAAATGTAGGTATTCCTTAAGG  1296232
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    1296166  TCAATGGTTTTCCAAACGATGTCAACGTGTCAGAGATTAAAATGTAGGTATTCCTTAAGG  1296225</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL195W YDL195W]
| 108307
| 108307
| Substitution
| T
| A
|-
| || colspan="6" | A single nucleotide substitution within the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine.
<pre>New    108300   AAGCCAACTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT  108359
                |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    108301   AAGCCATCTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT  108360</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="4"| 2011-02-03
| rowspan="4"| [https://www.yeastgenome.org/locus/YDL031W YDL031W]
| 396410
| 396410
| Insertion
| 
| T
|- style="height:30px; width:30px; text-align:center;"
| 396437
| 396437
| Deletion
| G
| 
|- style="height:30px; width:30px; text-align:center;"
| 396451
| 396451
| Substitution
| T
| G
|- style="height:30px; width:30px; text-align:center;"
| 396504
| 396504
| Substitution
| C
| G
|-
| || colspan="6" | Nucleotide changes within the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine.
<pre>New    396358   ACGAAAGGCGACTGAAAGAAGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTTTCACA  396417
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old    396356   ACGAAAGGCGACTGAAAGAAGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTT-CACA  396414</pre>

<pre>New    396418   TTCTATCGAAGATGAAATTTTG-AAAGGTGACGATGGTGAGACAGGTTACACCGTGTCAG  396476
                |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||
Old    396415   TTCTATCGAAGATGAAATTTTGGAAAGGTGACGATGTTGAGACAGGTTACACCGTGTCAG  396474</pre>

<pre>New    396477   AGGATGCCTTAAAAGAATTTGAAGATGCGGACCAATTATTAGAAGCACAGGAAAACGAAA  396536
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    396475   AGGATGCCTTAAAAGAATTTGAAGATGCGCACCAATTATTAGAAGCACAGGAAAACGAAA  396534</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL240W YDL240W]
| 24415
| 24415
| Substitution
| C
| A
|-
| || colspan="6" | A single nucleotide substitution within the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine.
<pre>New    24361    AGCATCTAACAAGGTAGGCAGAAACTCTTTACAGAGTACTATGCTAAAGGAACAAACTTA  24420
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    24361    AGCATCTAACAAGGTAGGCAGAAACTCTTTACAGAGTACTATGCTAAAGGAACACACTTA  24420</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR470C YDR470C]
| 1400867
| 1400867
| Substitution
| C
| T
|-
| || colspan="6" | A single nucleotide substitution within the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine.
<pre>New    1400863  CCAGCAGTTGTTCAAATATTTTTCGCCATTTCTGGATGTTAACCAATTCCGCCCATTCAA  1400922
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    1400856  CCAGCAGTTGTCCAAATATTTTTCGCCATTTCTGGATGTTAACCAATTCCGCCCATTCAA  1400915</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2011-02-03
| rowspan="2"| [https://www.yeastgenome.org/locus/YDL047W YDL047W], [https://www.yeastgenome.org/locus/YDL048C YDL048C]
| 369180
| 369180
| Insertion
| 
| A
|- style="height:30px; width:30px; text-align:center;"
| 369163
| 369163
| Insertion
| 
| G
|-
| || colspan="6" | Two separate single nucleotide insertions were made in the intergenic region between ORFs STP4/YDL048C and SIT4/YDL047W.
<pre>New    369144   CAAATTGCAAAGCCGCGGCGGTTCCCGGAAAAAAAAAAAGGAAGGCCACGCTATTGGTAA  369203
                |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Old    369144   CAAATTGCAAAGCCGCGGCG-TTCCCGGAAAAAAAAAA-GGAAGGCCACGCTATTGGTAA  369201</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL046W YDL046W], [https://www.yeastgenome.org/locus/YDL047W YDL047W]
| 371114
| 371114
| Insertion
| 
| A
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs SIT4/YDL047W and NPC2/YDL046W.
<pre>New    371099   ATCCCTGATAATAAAAAAACTTTAATCAACACTCGGGAGGGGAAATATAAAAGACTGGCG  371158
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    371097   ATCCCTGATAATAAAAAA-CTTTAATCAACACTCGGGAGGGGAAATATAAAAGACTGGCG  371155</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR541C YDR541C], [https://www.yeastgenome.org/locus/YDR542W YDR542W]
| 1522501
| 1522501
| Deletion
| T
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORF YDR541C and PAU10/YDR542W.
<pre>New    1522493  TCTGTACTCTTTTCTTTTCTTTC-TTTTTTTTTTTTAACAAGAAAAATGGTACCCGGGTA  1522551
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    1522478  TCTGTACTCTTTTCTTTTCTTTCTTTTTTTTTTTTTAACAAGAAAAATGGTACCCGGGTA  1522537</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR541C YDR541C], [https://www.yeastgenome.org/locus/YDRWdelta31 YDRWdelta31]
| 1519599
| 1519599
| Substitution
| C
| G
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between Ty1 LTR YDRWdelta31 and ORF YDR541C.
<pre>New    1519603  CTTATGGTTTCGCTTGATTATTTTGGCTTCACATAATTGCGAGATTATGTGTGGTATGGC  1519662
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    1519588  CTTATGGTTTCCCTTGATTATTTTGGCTTCACATAATTGCGAGATTATGTGTGGTATGGC  1519647</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| rowspan="3"| 2011-02-03
| rowspan="3"| [https://www.yeastgenome.org/locus/YDR539W YDR539W], [https://www.yeastgenome.org/locus/YDR540C YDR540C]
| 1516838
| 1516839
| Substitution
| TT
| ATTA
|- style="height:30px; width:30px; text-align:center;"
| 1516819
| 1516819
| Insertion
| 
| T
|- style="height:30px; width:30px; text-align:center;"
| 1516809
| 1516812
| Substitution
| GTGC
| TGTTGCT
|-
| || colspan="6" | Several small sequence changes were made in the intergenic region between ORFs FDC1/YDR539W and IRC4/YDR540C.
<pre>New    1516803  TATCGTCTATATCTTTGTTGCTTTAAAGGTTAGCGTATAGTAAGGTAAATTAACTATATG  1516862
                |||||||||||||||   ||| ||||||| ||||||||||||||||||  | ||||||||
Old    1516794  TATCGTCTATATCTT--GTGC-TTAAAGG-TAGCGTATAGTAAGGTAA--TTACTATATG  1516847</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR536W YDR536W], [https://www.yeastgenome.org/locus/YDR538W YDR538W]
| 1509885
| 1509885
| Insertion
| 
| G
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs STL1/YDR536W and PAD1/YDR538W.
<pre>New    1509883  TTCCGCTTGCCGGCAATGCCTATAAAAAGCTTATAAAATAGCCCGACTCCGTAGTCTTAA  1509942
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    1509875  TTCCGCTTGCC-GCAATGCCTATAAAAAGCTTATAAAATAGCCCGACTCCGTAGTCTTAA  1509933</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR533C YDR533C], [https://www.yeastgenome.org/locus/YDR534C YDR534C]
| 1502725
| 1502725
| Insertion
| 
| T
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs HSP31/YDR533C and FIT1/YDR534C.
<pre>New    1502693  TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAACTTTTTTTTTTAAATTCGGAT  1502752
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    1502686  TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAAC-TTTTTTTTTAAATTCGGAT  1502744</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL039C YDL039C], [https://www.yeastgenome.org/locus/YDL040C YDL040C]
| 381865
| 381865
| Deletion
| T
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs NAT1/YDL040C and PRM7/YDL039C.
<pre>New    381839   CAGAAAGAGTCTGATAATAATAATTTTTT-ATTGAATCCGAAGATATTCTATAATCAAAT  381897
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    381836   CAGAAAGAGTCTGATAATAATAATTTTTTTATTGAATCCGAAGATATTCTATAATCAAAT  381895</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL033C YDL033C], [https://www.yeastgenome.org/locus/YDL034W YDL034W]
| 392616
| 392616
| Substitution
| A
| G
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C.
<pre>New    392578   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCGGCGCATCGTATAAGGTGAT  392637
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    392576   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCAGCGCATCGTATAAGGTGAT  392635</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL234C YDL234C], [https://www.yeastgenome.org/locus/YDL235C YDL235C]
| 34008
| 34008
| Deletion
| T
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs YPD1/YDL235C and GYP7/YDL234C.
<pre>New    33961    TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTT-ATCAATGATCCA  34019
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    33961    TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTTTATCAATGATCCA  34020</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL183C YDL183C], [https://www.yeastgenome.org/locus/YDL184C YDL184C]
| 130626
| 130626
| Substitution
| T
| A
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs RPL41A/YDL184C and YDL183C.
<pre>New    130620   TGGGGAAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA  130679
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    130621   TGGGGTAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA  130680</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL182W YDL182W], [https://www.yeastgenome.org/locus/YDL183C YDL183C]
| 132292
| 132292
| Substitution
| T
| A
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs YDL183C and LYS20/YDL182W.
<pre>New    132240   TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATAAACGAAAA  132299
                ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    132241   TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATTAACGAAAA  132300</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL137W YDL137W], [https://www.yeastgenome.org/locus/YDL138W YDL138W]
| 215996
| 215996
| Insertion
| 
| C
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs RGT2/YDL138W and ARF2/YDL137W.
<pre>New    215950   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCCTTACAGGAGATCG  216009
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    215951   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACC-TTACAGGAGATCG  216009</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR334W YDR334W], [https://www.yeastgenome.org/locus/YDR335W YDR335W]
| 1140697
| 1140697
| Insertion
| 
| G
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs SWR1/YDR334W and MSN5/YDR335W.
<pre>New    1140653  GTCACCAATTTCTATTTACCGGGTGATGGCGGCGCGCCACAGCGGAGGGGCATTGCCACA  1140712
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    1140649  GTCACCAATTTCTATTTACCGGGTGATGGCGGCGCGCCACAGCGGAGGG-CATTGCCACA  1140707</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR324C YDR324C], [https://www.yeastgenome.org/locus/YDR325W YDR325W]
| 1117110
| 1117110
| Insertion
| 
| GG
|-
| || colspan="6" | A dinucleotide insertion was made in the intergenic region between ORFs UTP4/YDR324C and YCG1/YDR325W.
<pre>New    1117073  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACAGGCCGCGCCCATCATGCAAG  1117132
                ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    1117071  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACA--CCGCGCCCATCATGCAAG  1117128</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR072C YDR072C], [https://www.yeastgenome.org/locus/YDR073W YDR073W]
| 592033
| 592033
| Insertion
| 
| G
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs IPT1/YDR072C and SNF11/YDR073W.
<pre>New    592014   CAAGGATAACCCCGCTGTGCGGTGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG  592073
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    592013   CAAGGATAACCCCGCTGTGCG-TGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG  592071</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR062W YDR062W], [https://www.yeastgenome.org/locus/YDR063W YDR063W]
| 578232
| 578232
| Deletion
| T
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs LCB2/YDR062W and AIM7/YDR063W.
<pre>New    578215   AAACACGCAACGTCTTTTT-GACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC  578273
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    578213   AAACACGCAACGTCTTTTTTGACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC  578272</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR059C YDR059C], [https://www.yeastgenome.org/locus/YDR060W YDR060W]
| 569994
| 569994
| Insertion
| 
| G
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs UBC5/YDR059C and MAK21/YDR060W.
<pre>New    569985   ATGCTTCAAAAGCGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG  570044
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    569984   ATGCTTCAAAA-CGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG  570042</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR043C YDR043C], [https://www.yeastgenome.org/locus/snR47 snR47]
| 542033
| 542033
| Deletion
| A
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between snoRNA SNR47 and ORF NRG1/YDR043C.
<pre>New    541986   AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAA-CGCTTGCAGC  542044
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    541984   AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAAACGCTTGCAGC  542043</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR310C YDR310C], [https://www.yeastgenome.org/locus/YDR311W YDR311W]
| 1084534
| 1084534
| Deletion
| A
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs SUM1/YDR310C and TFB1/YDR311W.
<pre>New    1084494  AACACAAATGGTATTAAAAGGATAGATGAAAAAAAAAAAAAAA-TTAAAGCCACTAGTAA  1084552
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    1084491  AACACAAATGGTATTAAAAGGATAGATGAAAAAAAAAAAAAAAATTAAAGCCACTAGTAA  1084550</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDR300C YDR300C], [https://www.yeastgenome.org/locus/YDR301W YDR301W]
| 1063029
| 1063029
| Substitution
| C
| A
|-
| || colspan="6" | A single nucleotide substitution was made in the intergenic region between ORFs PRO1/YDR300C and CFT1/YDR301W.
<pre>New    1063014  AATAAATAAATTTAGACCAAAATGTAACCATTGATAAGTGAGAGTCTTAAATTTAACATG  1063073
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    1063011  AATAAATAAATTTAGACCCAAATGTAACCATTGATAAGTGAGAGTCTTAAATTTAACATG  1063070</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL071C YDL071C], [https://www.yeastgenome.org/locus/YDL072C YDL072C]
| 330573
| 330573
| Deletion
| T
| 
|-
| || colspan="6" | A single nucleotide deletion was made in the intergenic region between ORFs YET3/YDL072C and YDL071C.
<pre>New    330540   TTGCTATATACCATTGTTATATACGGCACTTTT-CCACTCTTCTTCCCCTTAATGGAGTG  330598
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    330540   TTGCTATATACCATTGTTATATACGGCACTTTTTCCACTCTTCTTCCCCTTAATGGAGTG  330599</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2011-02-03
| [https://www.yeastgenome.org/locus/YDL069C YDL069C], [https://www.yeastgenome.org/locus/YDL070W YDL070W]
| 332995
| 332995
| Insertion
| 
| A
|-
| || colspan="6" | A single nucleotide insertion was made in the intergenic region between ORFs BDF2/YDL070W and CBS1/YDL069C.
<pre>New    332949   ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAAATTGGGAAGAATGG  333008
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    332950   ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAA-TTGGGAAGAATGG  333008</pre>
'''Engel SR, et al.''' (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98<br>
[http://www.yeastgenome.org/reference/24374639/overview SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/24374639 PubMed] | [http://g3journal.org/content/4/3/389 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2008-06-05
| [https://www.yeastgenome.org/locus/YDL038C YDL038C], [https://www.yeastgenome.org/locus/YDL039C YDL039C]
| 382381
| 382381
| Insertion
| 
| G
|-
| || colspan="6" | Greg Prelich's lab discovered an error in the systematic reference sequence for Chromosome 4. This error was verified in the S288C strain background. Therefore, the following correction was made: insert a G after the G at 382381.
<pre>New: 1737   TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGGGTTCCCAACCTCAGACTGAAT 1678
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 382343 TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGG-TTCCCAACCTCAGACTGAAT 382401</pre>
As a result of this change, ORF YDL038C was merged into ORF PRM7/YDL039C. The new longer ORF is 2097 nt long. The name YDL038C is being retained as an alias for PRM7/YDL039C. <br>
'''Prelich G''' (2008) <br>
[https://www.yeastgenome.org/reference/S000126589 SGD papers]

|- style="height:30px; width:30px; text-align:center;"
| 2006-04-13
| [https://www.yeastgenome.org/locus/YDR015C YDR015C]
| 478023
| 478023
| Insertion
| 
| C
|-
| || colspan="6" | A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa).
<pre>New:    181 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAGCCCCAATGGG 240
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old: 477974 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAG-CCCAATGGG 478032</pre>
'''Tsubouchi''' H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
[https://www.yeastgenome.org/reference/S000117027 SGD papers] [https://www.ncbi.nlm.nih.gov/pubmed/16818607 PubMed] [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522073 Full-Text] [https://www.yeastgenome.org/reference/S000117028 Comments & Errata]

|- style="height:30px; width:30px; text-align:center;"
| 2006-01-19
| [https://www.yeastgenome.org/locus/YDR083W YDR083W]
| 613206
| 613206
| Insertion
| 
| G
|-
| || colspan="6" | SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, RRP8/YDR083W has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 383 to 392 amino acids.
Insert a G after the G at 613206

<pre>New: 613187 AAGACGGAAAATTGCCGAAGGAAAATGGCTCTTGAAGC 613224
            |||||||||||||||||||| |||||||||||||||||
Old: 613187 AAGACGGAAAATTGCCGAAG-AAAATGGCTCTTGAAGC 613223</pre>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
|- style="height:30px; width:30px; text-align:center;"
| 2004-07-22
| [https://www.yeastgenome.org/locus/YDR031W YDR031W]
| 503841
| 503841
| Insertion
| 
| G
|-
| || colspan="6" | The work of Kellis et al. 2003 predicted insertion of a single nucleotide within the coding region of YDR031W; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR031W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 117 to 121 amino acids.
<pre>New:    301 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTGGAATTAATCAAGGACTGA 355
            ||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old: 503805 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTG-AATTAATCAAGGACTGA 50385 </pre>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
|- style="height:30px; width:30px; text-align:center;"
| 2004-07-21
| [https://www.yeastgenome.org/locus/YDR179W-A YDR179W-A]
| 819479
| 819479
| Insertion
| 
| G
|-
| || colspan="6" | The work of Brachat et al. 2003 predicted insertion of a single nucleotide upstream of YDR179W-A; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR179W-A was extended at the 5' end, altering the N-terminus without changing the translation frame and increasing the size of the predicted protein from 268 to 463 amino acids.
<pre>New:      1 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAGGCCAAATGCCTCAAATC 60
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old: 819437 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAG-CCAAATGCCTCAAATC 819495 </pre>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]
|- style="height:30px; width:30px; text-align:center;"
| 2004-02-11
| [https://www.yeastgenome.org/locus/YDL127W YDL127W]
| 235713
| 235713
| Insertion
| 
| A
|-
| || colspan="6" | Kellis et al. 2003 predicted and confirmed the insertion of a single A nt. As a consequence of this sequence change, PCL2/YDL127W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 279 to 308 amino acids.
<pre>New: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAAATAGGCCAATACCGACAATTA 235734
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAA-TAGGCCAATACCGACAATTA 235733 </pre>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
|- style="height:30px; width:30px; text-align:center;"
| 2004-02-11
| [https://www.yeastgenome.org/locus/YDR007W YDR007W]
| 462037
| 462037
| Substitution
| A
| C
|-
| || colspan="6" | Although the systematic sequence for TRP1/YDR007W originally contained a nonsense (ochre) mutation at codon 67, systematic reference strain S288C does not actually contain this mutation in TRP1, which was introduced during the creation of strain AB972. AB972 is an ethidium bromide-induced derivative of the strain X2180-1B-trp1, which was supplied by E. Jones [M.V. Olson]. The lineage of AB972 traces directly to the strain S288C with no intervening outcrosses. The strain AB972 was the origin of the clone used for sequencing this segment of chromosome IV. In order to more accurately present this region of within the S288C reference strain, SGD has sequenced the S288C TRP1 locus and did not find the internal STOP codon. Thus, SGD has updated the TRP1 sequence by changing the previously annotated internal STOP (TAA) to serine (TCA).
<pre>New: 462018 AAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: 462018 AAAGCATATAAAAATAGTTAAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077 </pre>
|- style="height:30px; width:30px; text-align:center;"
| 2004-02-06
| [https://www.yeastgenome.org/locus/YDR359C YDR359C]
| 1192051
| 1192051
| Deletion
| A
| 
|-
| || colspan="6" | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggested that the stop site for YDR359C be moved 67 nt downstream. Jacques Cote and colleagues resequenced S288C, W303, and BY4741 and confirmed the deletion of a single A nt (see GenBank accession AY464182). As a consequence of this sequence change, the stop of YDR359C was moved 70 nt downstream, increasing the size of the predicted protein from 959 to 982 amino acids.
<pre>New: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGA-GACCCTGGTTGTAGTTGCTGCA 1192072
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGAAGACCCTGGTTGTAGTTGCTGCA 1192073</pre>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
|- style="height:30px; width:30px; text-align:center;"
| rowspan="2"| 2003-09-30
| rowspan="2"| [https://www.yeastgenome.org/locus/YDR474C YDR474C], [https://www.yeastgenome.org/locus/YDR475C YDR475C]
| 1409656
| 1409656
| Insertion
| 
| C
|- style="height:30px; width:30px; text-align:center;"
| 1409510
| 1409510
| Insertion
| 
| G
|-
| || colspan="6" | Due to insertion of G at position 1409511 and a C at position 1409657, YDR474C and JIP4/YDR475C have been merged. After merging YDR474C (1409119 - 1407452 (1-1668)) and JIP4/YDR475C (1410080 - 1409613 (1-468)), the coordinates of the merged ORF, JIP4/YDR475C, are 1410082 - 1407452 (1-2631). YDR474C is now an alias of JIP4/YDR475C. This sequence change was verified in strain S288C by SGD.
<pre>Old: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTG-CATACGCCC 1409519
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTGGCATACGCCC 1409520</pre>
<pre>Old: 1409640 GAGGTGGAGAAGAATAC-TGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409698
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New: 1409641 GAGGTGGAGAAGAATACCTGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409700</pre>
'''Blandin G, et al.''' (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 <br>
[https://www.yeastgenome.org/reference/S000065690 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11152879 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1016/S0014-5793%2800%2902275-4 Full-Text] <br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
|- style="height:30px; width:30px; text-align:center;"
| 2002-12-17
| [https://www.yeastgenome.org/locus/YDR325W YDR325W]
| 1117105
| 1117105
| Deletion
| G
| 
|-
| || colspan="6" | Due to the deletion of G at 1117105, the start for YDR325W has been moved 48 nt downstream from 1117069 to 1117116. The stop has not been changed. Thanks to Denise Bertsch for reporting this sequence error to SGD.
<pre>Old: 1117081 TTGGATAAGACAAAGAAGTTAACAGCCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117140
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New: 1117081 TTGGATAAGACAAAGAAGTTAACA-CCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117139</pre>
'''Lavoie BD, et al.''' (2002) In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol 156(5):805-15 <br>
[https://www.yeastgenome.org/reference/S000069542 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/11864994 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2173308 Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 2002-12-17
| [https://www.yeastgenome.org/locus/YDR494W YDR494W]
| 1437732
| 1437747
| Deletion
| GATCCTCCTTGATTTT
| 
|-
| || colspan="6" | Due to the deletion of 16 nt between 1437732-1437747, which had been tandemly duplicated in error, the coordinates of RSM28/YDR494W have been changed. The 16 nucleotides that were removed were near the 3' end of YDR494W, shifting the stop 235 nt downstream, for a net increase in length of 219 nt (from 867 nt to 1086 nt). See GenBank accession number AF459095. Thanks to Tom Fox for reporting this sequence error to SGD.
<pre>Old: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731
             |||||||||||||||||||||||||||||||||||||||||||||||||||
New: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731</pre>

<pre>Old: 1437732 gatcctccttgatttttgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437791
                             ||||||||||||||||||||||||||||||||||||||||||||
New: 1437732 ----------------tgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437775</pre>
|- style="height:30px; width:30px; text-align:center;"
| 2000-04-06
| [https://www.yeastgenome.org/locus/YDR470C YDR470C]
| 1400863
| 1400863
| Substitution
| T
| C
|-
| || colspan="6" | The T at coordinate 1400863 within YDR470C was replaced with a C (tgtCcaa). This results in a replacement of a Glu (GAA) with a Gly (GGA) on the Crick strand where the gene is located. This change was sent to SGD by Hartmut Wohlrab (wohlrab@bbri.org).
<pre>Old: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTTCAAATATTTTTCGCCAT 1400880
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTCCAAATATTTTTCGCCAT 1400880</pre>
'''Belenkiy R, et al.''' (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18 <br>
[https://www.yeastgenome.org/reference/S000049213 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10930523 PubMed Entry] | [https://www.sciencedirect.com/science/article/pii/S0005273600002224?via%3Dihub Full-Text]

|- style="height:30px; width:30px; text-align:center;"
| 1999-02-09
| [https://www.yeastgenome.org/locus/YDL048C YDL048C]
| 368211
| 368255
| Deletion
| CATTACTGAGTCAATGCTTGATGCA AAAGATGATGATACCAGCAT
| 
|-
| || colspan="6" | The first 45 nucleotides of YDL048C (from chromosomal coordinates 368211-368255) were deleted, leaving translation unaffected. This chunk was tandemly-duplicated in error.
<pre>Old: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210</pre>

<pre>Old: 368211 cattactgagtcaatgcttgatgcaaaagatgatgataccagcataggggaagccaaaga 368270
                                                         |||||||||||||||
New: 368211 ---------------------------------------------aggggaagccaaaga 368225</pre>

|}

<br><br>


=Annotation Changes ''without sequence changes''=
{| border="1" style="border-collapse:collapse; width:90%" cellpadding="6"
! Date  !! Affected Features 

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/ARS404 ARS404]<br> 
The chromosomal coordinates of the ARS consensus sequence annotated within ARS404 were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. <br><br>
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/ARS400 ARS400], [https://www.yeastgenome.org/locus/ARS403 ARS403], [https://www.yeastgenome.org/locus/ARS405 ARS405], [https://www.yeastgenome.org/locus/ARS406 ARS406], [https://www.yeastgenome.org/locus/ARS409 ARS409], [https://www.yeastgenome.org/locus/ARS410 ARS410], [https://www.yeastgenome.org/locus/ARS412 ARS412], [https://www.yeastgenome.org/locus/ARS413 ARS413], [https://www.yeastgenome.org/locus/ARS417 ARS417], [https://www.yeastgenome.org/locus/ARS419 ARS419], [https://www.yeastgenome.org/locus/ARS421 ARS421], [https://www.yeastgenome.org/locus/ARS422 ARS422], [https://www.yeastgenome.org/locus/ARS423 ARS423], [https://www.yeastgenome.org/locus/ARS425 ARS425], [https://www.yeastgenome.org/locus/ARS428 ARS428], [https://www.yeastgenome.org/locus/ARS429 ARS429], [https://www.yeastgenome.org/locus/ARS430 ARS430], [https://www.yeastgenome.org/locus/ARS431 ARS431], [https://www.yeastgenome.org/locus/ARS433 ARS433], [https://www.yeastgenome.org/locus/ARS440 ARS440], [https://www.yeastgenome.org/locus/ARS446 ARS446], [https://www.yeastgenome.org/locus/ARS451 ARS451]<br> 
As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome IV based on Liachko et al. 2013: ARS400, ARS403, ARS405, ARS406, ARS409, ARS410, ARS412, ARS413, ARS417, ARS419, ARS421, ARS422, ARS451, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS440, ARS446. <br><br>
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/ARS404 ARS404], [https://www.yeastgenome.org/locus/ARS409 ARS409], [https://www.yeastgenome.org/locus/ARS412 ARS412], [https://www.yeastgenome.org/locus/ARS415 ARS415], [https://www.yeastgenome.org/locus/ARS416 ARS416], [https://www.yeastgenome.org/locus/ARS417 ARS417], [https://www.yeastgenome.org/locus/ARS418 ARS418], [https://www.yeastgenome.org/locus/ARS419 ARS419], [https://www.yeastgenome.org/locus/ARS420 ARS420], [https://www.yeastgenome.org/locus/ARS421 ARS421], [https://www.yeastgenome.org/locus/ARS423 ARS423], [https://www.yeastgenome.org/locus/ARS430 ARS430], [https://www.yeastgenome.org/locus/ARS431 ARS431], [https://www.yeastgenome.org/locus/ARS435 ARS435], [https://www.yeastgenome.org/locus/ARS453 ARS453]<br> 
The chromosomal coordinates of the following ARS elements on Chromosome IV were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS404, ARS409, ARS412, ARS415, ARS416, ARS417, ARS418, ARS419, ARS420, ARS421, ARS423, ARS430, ARS431, ARS453, ARS435. <br><br>
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/ARS409.5 ARS409.5]<br> 
ARS409.5 was added to the genome annotation based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2. <br><br>
'''Liachko I, et al.''' (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704. <br>
[https://www.yeastgenome.org/reference/S000152760 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/23241746 PubMed] | [https://genome.cshlp.org/content/23/4/698 Full-Text]

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/YDR134C YDR134C]<br> 
The feature_type annotation of YDR134C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2. <br><br>
|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/YDR098C YDR098C]<br> 
The annotated translation start for GRX3/YDR098C was moved 105 nt downstream to what was previously Met36, based on Li et al. 2009 as part of SGD's genome annotation revision R64.2. <br><br>
<pre>Old chromosomal coords: 645035..644178     Old relative coords: 1..858
New chromosomal coords: 644930..644178     New relative coords: 1..753</pre>
'''Li H, et al.''' (2009) The yeast iron regulatory proteins Grx3/4 and Fra2 form heterodimeric complexes containing a [2Fe-2S] cluster with cysteinyl and histidyl ligation. Biochemistry 48(40):9569-81 <br>
[https://www.yeastgenome.org/reference/S000131452 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/19715344 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2796373 Full-Text]

|-
| 2014-11-18
| [https://www.yeastgenome.org/locus/ETC1 ETC1], [https://www.yeastgenome.org/locus/ETC6 ETC6]<br> 
The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012 as part of SGD's genome annotation revision R64.2: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8. <br><br>
'''Hiraga SI, et al.''' (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54 <br>
[https://www.yeastgenome.org/reference/S000149071 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/22496415 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3395662 Full-Text] 

|-
| 2009-05-07
| [https://www.yeastgenome.org/locus/ARS411 ARS411], [https://www.yeastgenome.org/locus/ARS412 ARS412], [https://www.yeastgenome.org/locus/ARS415 ARS415], [https://www.yeastgenome.org/locus/ARS420 ARS420], [https://www.yeastgenome.org/locus/ARS427 ARS427], [https://www.yeastgenome.org/locus/ARS436 ARS436], [https://www.yeastgenome.org/locus/ARS439 ARS439], [https://www.yeastgenome.org/locus/ARS442 ARS442]<br> 
The following ARS elements on Chromosome 4 were added to the genome annotation based on Raveendranathan et al. 2006: ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, and ARS442. <br><br>
'''Raveendranathan M, et al.''' (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 <br>
[https://www.yeastgenome.org/reference/S000117571 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16888628 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1538557 Full-Text] 

|-
| 2007-07-10
| [https://www.yeastgenome.org/locus/YDL115C YDL115C]<br> 
The start of ORF IWR1/YDL115C was moved 409 nt upstream and an intron was added at relative coordinates 83-152 based on experimental evidence in Juneau et al. 2007 and Miura et al. 2006. See also GenBank EF123147 and Brachat et al. 2003. Note that this is the same intron that was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but then removed awaiting experimental evidence. <br><br>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]<br>
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 <br>
[https://www.yeastgenome.org/reference/S000119659 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1693835/ Full-Text] | [https://www.pnas.org/content/suppl/2006/11/14/0605645103.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17101987&db=pmid YFGdb] <br>
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 <br>
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.yeastgenome.org/reference/S000120506 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1780280 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17244705&db=pmid YFGdb] <br>

|-
| 2007-04-27
| [https://www.yeastgenome.org/locus/YDL189W YDL189W]<br> 
RBS1/YDL189W mRNA contains an intron in the 5' untranslated region (UTR). [see GenBank Accession #AY245794; Zhang, Z and Dietrich, F.S] <br><br>
'''Davis CA and Ares M Jr''' (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7 <br>
[https://www.yeastgenome.org/reference/S000114459 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16484372 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1413877 Full-Text] | [https://www.pnas.org/content/suppl/2006/02/16/0507783103.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=16484372&db=pmid YFGdb] 

|-
| 2007-04-04
| [https://www.yeastgenome.org/locus/YDR099W YDR099W]<br> 
BMH2/YDR099W mRNA contains an intron in the 5' untranslated region (UTR). <br><br>
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 <br>
[https://www.yeastgenome.org/reference/S000119659 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1693835/ Full-Text] | [https://www.pnas.org/content/suppl/2006/11/14/0605645103.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17101987&db=pmid YFGdb] <br>
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 <br>
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.yeastgenome.org/reference/S000120506 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1780280 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17244705&db=pmid YFGdb] <br>
'''Zhang Z, et al.''' (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 <br>
[https://www.yeastgenome.org/reference/S000121920 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17351133 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1832097 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17351133&db=pmid YFGdb] 

|-
| 2007-04-04
| [https://www.yeastgenome.org/locus/YDL137W YDL137W]<br> 
ARF2/YDL137W mRNA contains an intron in the 5' untranslated region (UTR). <br><br>
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 <br>
[https://www.yeastgenome.org/reference/S000119659 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1693835/ Full-Text] | [https://www.pnas.org/content/suppl/2006/11/14/0605645103.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17101987&db=pmid YFGdb] <br>
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 <br>
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.yeastgenome.org/reference/S000120506 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1780280 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17244705&db=pmid YFGdb] <br>

|-
| 2007-04-04
| [https://www.yeastgenome.org/locus/YDL061C YDL061C]<br> 
RPS29B/YDL061C mRNA contains an intron in the 5' untranslated region (UTR). <br><br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>
'''Miura F, et al.''' (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 <br>
[https://www.yeastgenome.org/reference/S000119659 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/17101987 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1693835/ Full-Text] | [https://www.pnas.org/content/suppl/2006/11/14/0605645103.DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17101987&db=pmid YFGdb] <br>
'''Juneau K, et al.''' (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 <br>
[https://www.yeastgenome.org/reference/S000120506 SGD paper] | [https://www.yeastgenome.org/reference/S000120506 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1780280 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=17244705&db=pmid YFGdb] <br>

|-
| 2007-04-04
| [https://www.yeastgenome.org/locus/snR47 snR47]<br> 
The coordinates of both the 5' and 3' ends of snR47 were shifted 47 nucleotides towards the left end of the chromosome to match those given in the yeast snoRNA database at UMass Amherst and as reported in Balakin AG et al. (1996) and the corresponding GenBank entry U56648. Thanks to Jason Hoskins for reporting this discrepancy and to Wayne Decatur for providing additional confirmation. <br><br>
'''Balakin AG, et al.''' (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34 <br>
[https://www.yeastgenome.org/reference/S000042180 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8797828 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400801567?via%3Dihub Full-Text] 

|-
| 2007-04-02
| [https://www.yeastgenome.org/locus/YDRCsigma4 YDRCsigma4]<br> 
YDRWsigma4, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRCsigma4 and is annotated on the Crick strand. The name YDRWsigma4 is being retained as an alias. <br><br>
|-
| 2007-04-02
| [https://www.yeastgenome.org/locus/YDRWsigma2 YDRWsigma2]<br> 
YDRCsigma2, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRWsigma2 and is annotated on the Watson strand. The name YDRCsigma2 is being retained as an alias. <br><br>
|-
| 2007-03-06
| [https://www.yeastgenome.org/locus/ARS416 ARS416]<br> 
The ACS within ARS1/ARS416 was annotated based on Xu et al. 2006 and Celniker et al. 1984. <br><br>
'''Celniker SE, et al.''' (1984) Deletion mutations affecting autonomously replicating sequence ARS1 of Saccharomyces cerevisiae. Mol Cell Biol 4(11):2455-66 <br>
[https://www.yeastgenome.org/reference/S000047468 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/6392851 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC369077 Full-Text] <br>
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 <br>
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1657020 Full-Text]<br>

|-
| 2007-03-06
| [https://www.yeastgenome.org/locus/ARS404 ARS404]<br> 
The ACS within ARS404 was annotated based on Xu et al. 2006 and Russell et al. 1986. <br><br>
'''Russell DW, et al.''' (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94 <br>
[https://www.yeastgenome.org/reference/S000056129 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3025649 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC367210 Full-Text] <br>
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 <br>
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1657020 Full-Text]<br>

|-
| 2007-03-06
| [https://www.yeastgenome.org/locus/ARS400 ARS400]<br> 
ARS400 was added to the genome annotation on Chromosome IV at coordinates 137-1392 based on Xu et al. 2006. <br><br>
'''Xu W, et al.''' (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276 <br>
[https://www.yeastgenome.org/reference/S000119399 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/17067396 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1657020 Full-Text]<br>

|-
| 2006-10-05
| [https://www.yeastgenome.org/locus/ARS432 ARS432], [https://www.yeastgenome.org/locus/ARS450 ARS450], [https://www.yeastgenome.org/locus/ARS451 ARS451], [https://www.yeastgenome.org/locus/ARS452 ARS452], [https://www.yeastgenome.org/locus/ARS453 ARS453]<br> 
The following ARS elements on Chromosome IV, in addition to the ARS Consensus Sequence (ACS) for ARS432, were added to the genome annotation based on Nieduszynski et al. 2006: ARS450/417.5, ARS451/422.5, ARS452/431.5, ARS453/432.5. <br><br>
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br>
[https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] 

|-
| 2006-09-08
| [https://www.yeastgenome.org/locus/ARS403 ARS403], [https://www.yeastgenome.org/locus/ARS405 ARS405], [https://www.yeastgenome.org/locus/ARS406 ARS406], [https://www.yeastgenome.org/locus/ARS409 ARS409], [https://www.yeastgenome.org/locus/ARS410 ARS410], [https://www.yeastgenome.org/locus/ARS413 ARS413], [https://www.yeastgenome.org/locus/ARS414 ARS414], [https://www.yeastgenome.org/locus/ARS417 ARS417], [https://www.yeastgenome.org/locus/ARS418 ARS418], [https://www.yeastgenome.org/locus/ARS419 ARS419], [https://www.yeastgenome.org/locus/ARS421 ARS421], [https://www.yeastgenome.org/locus/ARS423 ARS423], [https://www.yeastgenome.org/locus/ARS425 ARS425], [https://www.yeastgenome.org/locus/ARS428 ARS428], [https://www.yeastgenome.org/locus/ARS429 ARS429], [https://www.yeastgenome.org/locus/ARS430 ARS430], [https://www.yeastgenome.org/locus/ARS431 ARS431], [https://www.yeastgenome.org/locus/ARS433 ARS433], [https://www.yeastgenome.org/locus/ARS434 ARS434], [https://www.yeastgenome.org/locus/ARS435 ARS435], [https://www.yeastgenome.org/locus/ARS440 ARS440], [https://www.yeastgenome.org/locus/ARS443 ARS443], [https://www.yeastgenome.org/locus/ARS446 ARS446]<br> 
The following new ARS elements on Chromosome IV were added to SGD based on Nieduszynski et al. 2006: ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446. <br><br>
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br>
[https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] 

|-
| 2006-09-08
| [https://www.yeastgenome.org/locus/ARS422 ARS422]<br> 
The coordinates of ARS422 were updated based on Nieduszynski et al. 2006. <br><br>
'''Nieduszynski CA, et al.''' (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9<br>
[https://www.yeastgenome.org/reference/S000117321 SGD papers] | [https://www.ncbi.nlm.nih.gov/pubmed/16847347 PubMed Entry] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522085 Full-Text] | [http://genesdev.cshlp.org/content/20/14/1874/suppl/DC1 Web Supplement] 

|-
| 2006-05-08
| [https://www.yeastgenome.org/locus/CEN4 CEN4]<br> 
The previously annotated 3' boundary of CEN4 was adjusted to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. <br><br>
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 <br>
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC29730 Full-Text] <br>
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 <br>
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC266772 Full-Text]

|-
| 2006-04-14
| [https://www.yeastgenome.org/locus/YDR014W-A YDR014W-A]<br> 
New ORF HED1/YDR014W-A was added to the genome annotation for Chromosome IV at coordinates 477794 - 478282 based on Tsubouchi & Roeder 2005. <br><br>
'''Tsubouchi H and Roeder GS''' (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 <br>
[https://www.yeastgenome.org/reference/S000117027 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16818607 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522073 Full-Text] | [https://www.yeastgenome.org/reference/S000117028 Comments & Errata]

|-
| 2006-04-13
| [https://www.yeastgenome.org/locus/YDR015C YDR015C]<br> 
Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957. <br><br>
'''Tsubouchi H and Roeder GS''' (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 <br>
[https://www.yeastgenome.org/reference/S000117027 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/16818607 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1522073 Full-Text] | [https://www.yeastgenome.org/reference/S000117028 Comments & Errata]

|-
| 2006-04-13
| [https://www.yeastgenome.org/locus/YDL200C YDL200C]<br> 
The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for MGT1/YDL200C was moved 54 nt (18 codons) downstream. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2006-04-12
| [https://www.yeastgenome.org/locus/YDL065C YDL065C], [https://www.yeastgenome.org/locus/YDL216C YDL216C]<br> 
The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al. and this was incorporated into SGD. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2006-04-12
| [https://www.yeastgenome.org/locus/YDR422C YDR422C]<br> 
Based on mutant analysis by Hedbacker et al. 2004, the start codon for SIP/YDR422C was moved 144 bp (48 codons) downstream. Hedbacker et al. 2004 showed that the first ATG of the ORF is not required for expression of functional Sip1p. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. <br><br>
'''Hedbacker K, et al.''' (2004) Cyclic AMP-dependent protein kinase regulates the subcellular localization of Snf1-Sip1 protein kinase. Mol Cell Biol 24(5):1836-43 <br>
[https://www.yeastgenome.org/reference/S000075818 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/14966266 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC350547 Full-Text] <br>

|-
| 2006-04-12
| [https://www.yeastgenome.org/locus/ARS422 ARS422]<br> 
ARS422, also known as "ARO1 ARS", was added to the genome annotation for Chromosome IV at coordinates 702799-703275 based on Wyrick et al. 2001 and Larimer et al. 1983. <br><br>
'''Larimer FW, et al.''' (1983) Isolation of the ARO1 cluster gene of Saccharomyces cerevisiae. Mol Cell Biol 3(9):1609-14 <br>
[https://www.yeastgenome.org/reference/S000039885 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/6355828 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC370014 Full-Text] <br>
'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 <br>
[https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11743203&db=pmid YFGdb] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]

|-
| 2006-04-10
| [https://www.yeastgenome.org/locus/ARS416 ARS416]<br> 
ARS416, originally designated ARS1, was added to the genome annotation for Chromosome IV at coordinates 462351-463189 based on Wyrick et al. 2001, Stinchcomb et al. 1979, and GenBank Accession U01086. "ARS1" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS416" is being used for consistency purposes, to indicate that this ARS is part of Chromosome IV. <br><br>
'''Stinchcomb DT, et al.''' (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature 282(5734):39-43 <br>
[https://www.yeastgenome.org/reference/S000039278 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/388229 PubMed] | [https://www.nature.com/articles/282039a0 Full-Text] <br>
'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 <br>
[https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11743203&db=pmid YFGdb] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]

|-
| 2006-04-10
| [https://www.yeastgenome.org/locus/ARS404 ARS404]<br> 
ARS404, also known as "HO ARS", was added to the genome annotation for Chromosome IV at coordinates 45919-46272 based on Wyrick et al. 2001 and Russell et al. 1986. <br><br>
'''Russell DW, et al.''' (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94 <br>
[https://www.yeastgenome.org/reference/S000056129 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/3025649 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC367210 Full-Text] <br>
'''Wyrick JJ, et al.''' (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 <br>
[https://www.yeastgenome.org/reference/S000069019 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11743203 PubMed] | [https://science.sciencemag.org/content/294/5550/2357 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11743203&db=pmid YFGdb] | [https://www.ncbi.nlm.nih.gov/pubmed/11743187 Comments & Errata]

|-
| 2005-11-22
| [https://www.yeastgenome.org/locus/YDL208W YDL208W]<br> 
The start site of NHP2/YDL208W is being moved 51 bp downstream from 87462 to 87513 based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. This annotation change was also suggested by Kellis et al. 2003. The annotated protein is reduced in length from 173 aa to 156 aa. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
[https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>

|-
| 2005-11-22
| [https://www.yeastgenome.org/locus/YDR378C YDR378C]<br> 
The start site of LSM6/YDR378C is being moved 111 bp downstream from 1229710 to 1229599, based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. Bouveret et al. 2000 also suggested this new start site because it is consistent with the protein's apparent molecular mass of 9.3 kDa, and is supported by comparison of the yeast Lsm6p sequence with homologs from other organisms. The annotated size of the protein changes from 123 aa to 86 aa. <br><br>
'''Bouveret E, et al.''' (2000) A Sm-like protein complex that participates in mRNA degradation. EMBO J 19(7):1661-71
[https://www.yeastgenome.org/reference/S000050418 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10747033 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC310234 Full-Text] <br>
'''Zhang Z and Dietrich FS''' (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51. <br>
[https://www.yeastgenome.org/reference/S000082006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/15905473 PubMed] | [https://academic.oup.com/nar/article/33/9/2838/2401448 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=15905473&db=pmid YFGdb]<br>

|-
| 2005-11-16
| [https://www.yeastgenome.org/locus/YDL007C-A YDL007C-A], [https://www.yeastgenome.org/locus/YDR119W-A YDR119W-A], [https://www.yeastgenome.org/locus/YDR374W-A YDR374W-A], [https://www.yeastgenome.org/locus/YDR461C-A YDR461C-A]<br> 
Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following new ORFs be added to the S. cerevisiae genome annotation: YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A. <br><br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2004-10-12
| [https://www.yeastgenome.org/locus/CEN4 CEN4]<br> 
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. <br><br>
'''Wieland G, et al.''' (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 <br>
[https://www.yeastgenome.org/reference/S000059647 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11222754 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC29730 Full-Text] <br>
'''Espelin CW, et al.''' (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 <br>
[https://www.yeastgenome.org/reference/S000074756 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/13679521 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC266772 Full-Text]

|-
| 2004-04-01
| [https://www.yeastgenome.org/locus/snR84 snR84]<br> 
Start and stop coordinates updated per McCutcheon & Eddy 2004. <br><br>
'''McCutcheon JP and Eddy SR''' (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003 <br>
[https://www.yeastgenome.org/reference/S000175486 SGD paper] | [https://www.yeastgenome.org/sgdpub/mccutcheon_ruf_correction.pdf Web Supplement]

|-
| 2004-02-24
| [https://www.yeastgenome.org/locus/YDL115C YDL115C]<br> 
Davis et al. 2000 demonstrated that there is an intron in the 5'UTR of IWR1/YDL115C that does not affect the coding region. Based on sequence comparison with related fungi, Brachat et al. 2003 later predicted a different intron that would extend the N-terminus of IWR1/YDL115C. Brachat et al. predict that the intron uses the same 5' splice junction demonstrated by Davis et al., but a different 3' splice junction. The intron predicted by Brachat et al. was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but was then removed and will be not annotated again until supported by experimental evidence. <br><br>

Intron and splice junctions confirmed by Davis et al.:
<pre>1st exon   ...GGATTCTGTG CAGGCATTAT 
  intron   GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG TAATTGATGA GGGGAAAAG
2nd exon   AGTGAAGAAG CAGAAGTTCA... </pre>
Intron and splice junctions predicted by Brachat et al.:
<pre>1st exon   ...GGATTCTGTG CAGGCATTAT
  intron   GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG
2nd exon   TAATTGATGA GGGGAAAAGA... </pre>
'''Davis CA, et al.''' (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6<br>
[https://www.yeastgenome.org/reference/S000042737 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10734188 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC102823 Full-Text]<br>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text] <br>

|-
| 2004-01-26
| [https://www.yeastgenome.org/locus/YDR381C-A YDR381C-A]<br> 
Increased the size of the intron in YDR381C-A by 1 bp on 5' end and 2 bp on 3' end based on conserved splice site sequences. See Blandin et al. 2000. <br><br>
'''Blandin G, et al.''' (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 <br>
[https://www.yeastgenome.org/reference/S000065690 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11152879 PubMed] | [https://febs.onlinelibrary.wiley.com/doi/full/10.1016/S0014-5793%2800%2902275-4 Full-Text]<br>

|-
| 2004-01-23
| [https://www.yeastgenome.org/locus/YDL115C YDL115C]<br> 
Based on analyses of homology and synteny in Ashbya gossypii and Candida albicans, Brachat et al. (2003) proposed an intron and 5' extension for IWR1/YDL115C. The resulting ORF is in the same frame with the start codon shifted 409 bp upstream, now including a 70-bp intron; the protein has a 113-residue extension at the N-terminus. <br><br>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]

|-
| 2003-09-27
| [https://www.yeastgenome.org/locus/YDR318W YDR318W]<br> 
Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for MCM21/YDR318W. The resulting ORF is in the same frame with the start moved 434 nt upstream, and the protein has a 117-residue extension at the N-terminus. The same intron and 5' exon are also described by Ortiz et al. 1999. <br><br>
'''Ortiz J, et al.''' (1999) A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore. Genes Dev 13(9):1140-55 <br>
[https://www.yeastgenome.org/reference/S000054451 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10323865 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC316948 Full-Text]<br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDL069C YDL069C]<br> 
The start site of CBS1/YDL069C was moved 12 nt (4 codons) downstream, based on automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Deletion analyses by Krause-Bucholz et al. 2000 demonstrate that N-terminal sequences are not essential for either the function or mitochondrial targeting of this protein. <br><br>
'''Krause-Buchholz U, et al.''' (2000) Identification of functionally important regions of the Saccharomyces cerevisiae mitochondrial translational activator Cbs1p. Yeast 16(4):353-63 <br>
[https://www.yeastgenome.org/reference/S000042227 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10669873 PubMed] | [https://dx.doi.org/10.1002/(SICI)1097-0061(20000315)16:4&lt;353::AID-YEA539&gt;3.0.CO;2-%23 Full-Text] <br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR383C YDR383C]<br> 
Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NKP1/YDR383C was moved 42 nt (14 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR400W YDR400W]<br> 
Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for URH1/YDR400W was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This start site was previously proposed by Kurtz et al, who noted that translation from this second methionine is more consistent with the observed size of URH1 and has closer similarity to related proteins. <br><br>
'''Kurtz JE, et al.''' (2002) The URH1 uridine ribohydrolase of Saccharomyces cerevisiae. Curr Genet 41(3):132-41 <br>
[https://www.yeastgenome.org/reference/S000070131 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12111094 PubMed] | [https://link.springer.com/article/10.1007%2Fs00294-002-0296-9 Full-Text] <br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR205W YDR205W]<br> 
The start site of MSC2/YDR205W was moved 48 nt (16 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR486C YDR486C]<br> 
Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for VPS60/YDR486C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDL144C YDL144C]<br> 
The start site of YDL144C was moved 9 nt (3 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR463W YDR463W]<br> 
Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for STP1/YDR463W was moved 174 nt (58 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Previously published data from Wang et al. demonstrate that the second in frame methionine is the most likely start codon. <br><br>
'''Wang SS, et al.''' (1992) STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs. Mol Cell Biol 12(6):2633-43 <br>
[https://www.yeastgenome.org/reference/S000041872 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/1588961 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC364457 Full-Text] <br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDL139C YDL139C]<br> 
The start site of YDL139C was moved 72 nt (24 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR083W YDR083W]<br> 
The start site of RRP8/YDR083W was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-22
| [https://www.yeastgenome.org/locus/YDR485C YDR485C]<br> 
Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for VPS72/YDR485C was moved 45 nt (15 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. <br><br>
'''Kellis M, et al.''' (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54. <br>
[https://www.yeastgenome.org/reference/S000073327 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12748633 PubMed] | [https://www.nature.com/articles/nature01644 Full-Text] | [https://www.yeastgenome.org/reference/S000140268 Comments & Errata] <br>
'''Cliften P, et al.''' (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6. <br>
[https://www.yeastgenome.org/reference/S000073948 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12775844 PubMed] | [https://science.sciencemag.org/content/301/5629/71.long Full-Text] | [https://science.sciencemag.org/content/suppl/2003/07/03/1084337.DC1 Web Supplement] <br>

|-
| 2003-09-09
| [https://www.yeastgenome.org/locus/TEL04L TEL04L], [https://www.yeastgenome.org/locus/TEL04R TEL04R]<br> 
The chromosomal locations for the following telomeric elements on Chromosome IV were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL04L, TEL04L-XC, TEL04L-XR, TEL04L-TR, TEL04R, TEL04R-XC, TEL04R-XR, TEL04R-TR, TEL04R-YP. <br><br>
|-
| 2003-07-29
| [https://www.yeastgenome.org/locus/YDL025W-A YDL025W-A], [https://www.yeastgenome.org/locus/YDL086C-A YDL086C-A], [https://www.yeastgenome.org/locus/YDL159C-B YDL159C-B], [https://www.yeastgenome.org/locus/YDR354C-A YDR354C-A], [https://www.yeastgenome.org/locus/YDR464C-A YDR464C-A], [https://www.yeastgenome.org/locus/YDR510C-A YDR510C-A], [https://www.yeastgenome.org/locus/YDR524C-A YDR524C-A], [https://www.yeastgenome.org/locus/YDR545C-A YDR545C-A]<br> 
Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A. <br><br>
'''Kumar A, et al.''' (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63. <br>
[https://www.yeastgenome.org/reference/S000073673 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/11753363 PubMed] | [https://www.nature.com/articles/nbt0102-58 Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=11753363&db=pmid YFGdb] | [https://www.yeastgenome.org/reference/S000141796 Comments & Errata] <br>

|-
| 2003-07-29
| [https://www.yeastgenome.org/locus/YDL160C-A YDL160C-A]<br> 
Thanks to Brachat et al. for providing the coordinates of ORF YDL160C-A. <br><br>
'''Brachat S, et al.''' (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45. <br>
[https://www.yeastgenome.org/reference/S000073670 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12844361 PubMed] | [https://genomebiology.biomedcentral.com/articles/10.1186/gb-2003-4-7-r45 Full-Text]

|-
| 2003-07-29
| [https://www.yeastgenome.org/locus/YDL022C-A YDL022C-A], [https://www.yeastgenome.org/locus/YDR169C-A YDR169C-A], [https://www.yeastgenome.org/locus/YDR182W-A YDR182W-A], [https://www.yeastgenome.org/locus/YDR183C-A YDR183C-A], [https://www.yeastgenome.org/locus/YDR194W-A YDR194W-A], [https://www.yeastgenome.org/locus/YDR246W-A YDR246W-A], [https://www.yeastgenome.org/locus/YDR406W-A YDR406W-A]<br> 
Thanks to Kessler et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A. <br><br>
'''Kessler MM, et al.''' (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71. <br>
[https://www.yeastgenome.org/reference/S000073671 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12566404 PubMed] | [https://genome.cshlp.org/content/13/2/264.long Full-Text] <br>

|-
| 2003-07-29
| [https://www.yeastgenome.org/locus/YDR003W-A YDR003W-A], [https://www.yeastgenome.org/locus/YDR118W-A YDR118W-A], [https://www.yeastgenome.org/locus/YDR320W-B YDR320W-B], [https://www.yeastgenome.org/locus/YDR371C-A YDR371C-A]<br> 
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome IV: YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A. <br><br>
'''Basrai MA, et al.''' (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 <br>
[https://www.yeastgenome.org/reference/S000042214 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/10490641 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC84699 Full-Text] <br>
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>
'''Oshiro G, et al.''' (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20. <br>
[https://www.yeastgenome.org/reference/S000073672 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12176929 PubMed] | [https://genome.cshlp.org/content/12/8/1210.long Full-Text] | [https://genome.cshlp.org/content/12/8/1210/suppl/DC1 Web Supplement] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=12176929&db=pmid YFGdb] <br>

|-
| 2003-07-29
| [https://www.yeastgenome.org/locus/YDR524C-B YDR524C-B], [https://www.yeastgenome.org/locus/YDR524W-C YDR524W-C]<br> 
Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome IV: YDR524C-B, YDR524W-A. <br><br>
|-
| 2003-03-06
| [https://www.yeastgenome.org/locus/snR84 snR84]<br> 
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. <br><br>
'''McCutcheon JP and Eddy SR''' (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28 <br>
[https://www.yeastgenome.org/reference/S000074006 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/12853629 PubMed] | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC165953 Full-Text] | [https://www.yeastgenome.org/reference/S000175486 Comments & Errata]<br>

|-
| 2001-03-09
| [https://www.yeastgenome.org/locus/snR47 snR47]<br> 
Changed from W -> C: old start coord: 541641; old stop coord: 541701 new start coord: 541739; new stop coord: 541641. <br><br>
#'''Balakin AG, et al.''' (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34 <br>
[https://www.yeastgenome.org/reference/S000042180 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/8797828 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400801567?via%3Dihub Full-Text] , Ni et al. (1996) Cell 86(5):823-834 <br>
#[http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataBase.html snoRNA database] <br>
#Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706 

|-
| 2001-01-30
| [https://www.yeastgenome.org/locus/YDL085C-A YDL085C-A]<br> 
ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood). <br><br>
|-
| 2000-12-01
| [https://www.yeastgenome.org/locus/YDR139C YDR139C]<br> 
The intron of ORF YDR139C was moved 3 nt downstream as a whole, changing the relative coordinates of the coding region from 1-146..220-307 to 1-149..223-307. Note that while the coding sequence has changed slightly, the genomic sequence remains unchanged. <br><br>
|-
| 2000-07-22
| [https://www.yeastgenome.org/locus/YDL189W YDL189W]<br> 
The start site of ORF YDL189W was moved 238 nt downstream and the annotated intron was removed, changing the relative coordinates of the coding region from 1-100..246-1612 to 1-1374. Note that the stop remains unchanged. <br><br>
|-
| 1999-07-17
| [https://www.yeastgenome.org/locus/YDR381W YDR381W]<br> 
A new intron and 5' exon were added to YDR381W. Relative coordinates change from 1-321 to 1-285..1052-1447, and chromosomal coordinates change from 1237718-1238038 to 1236547-1236831..1237598-1237993. <br><br>
|-
| 1998-05-21
| [https://www.yeastgenome.org/locus/YDL130W-A YDL130W-A], [https://www.yeastgenome.org/locus/YDR034C-A YDR034C-A], [https://www.yeastgenome.org/locus/YDR034W-B YDR034W-B], [https://www.yeastgenome.org/locus/YDR363W-A YDR363W-A], [https://www.yeastgenome.org/locus/YDR525W-A YDR525W-A]<br> 
The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A. The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD. <br><br>
'''Velculescu VE, et al.''' (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51. <br>
[https://www.yeastgenome.org/reference/S000058021 SGD paper] | [https://www.ncbi.nlm.nih.gov/pubmed/9008165 PubMed] | [https://www.sciencedirect.com/science/article/pii/S0092867400818450?via%3Dihub Full-Text] | [http://yfgdb.princeton.edu/cgi-bin/display.cgi?id=9008165&db=pmid YFGdb] <br>

|}